Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig28215  (registered. 2012)
Contig Information
Length 812 bp
Clones alternative view 12 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 2
Wh_RDr Root of dessiccated seed 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 4
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|226493141|ref|NP_001146282.1|| hypothetical protein LOC100279857 [Zea mays]
Score 153
Evalue 3.00E-48
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig28215
TGTTGTAATTTCGCCCGATGGATTGTTCCCTTCACTCTACCGAGAAGTTATACGAAGAGCACCACATGAGTTCAAGATTGCCTGTCTGGAGAGACACTGA
CGAGCTTACGTACAAAAAGATGGGAATTTCGAAAGGCAAGATTTTTATCATCAACCCCAAGGGTGAAGTGGCCATCAATAGTTCAGTTGATGTGAAGTCC
TATACCTCCTTGCATACCCTTGTCAATGACATGTTCCCTCCAACAACTTTGGTTGAGCAGGAAGATTACAACTCCTGGAATTATTGGAAGGTGCCGCTGC
CAGACATTGATTTGTAGAGTAGTTTTGACAAGTACAGCAGTAGATGCAAGTAGAGTCTGTGGACAGCATGACAGGCAAGTTCGTGTACGCTAGTTCTCAA
TCGCCACAGCAGAATTCTGTTCAACCTGTAAAGCATCTGGTGAGTTTTCCAGATGGACTGTGTTGATCGCCGTTGTTGCAGAAGCTCGATTTTCCTTGCT
CCGACGCAGCGCCATCACGATCATTCATCTTTTAGGTAGTGATCTGATTGTCATGGCCGTCGTTAAAACTTATCGCTGCTGTGCTGGCATCTCAATTCGC
AACGATGTAGCCCGCCGAGCTTGTTTGTTAATCTGTTGTCAGCAGCTGCTAGACTCTGTTGCTTTCCTTGTTCTTGTAGCTCTAGGCTGTGATGTCAGTT
AGATTACTCGTGGTACATTACTGGAAAGCAACAGGGAACAGAAACTGTCAATCCGCTGTATGTTGTTGTATATGGGATATAAATACGACTGCATTTTTCT
GTAAAAAAAAAA
page-top