Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig28145  (registered. 2012)
Contig Information
Length 765 bp
Clones alternative view 2 Clones [Download: TSV  ,  FASTA ]
Wh_h Spike at heading date 1
WH_XT Roots, 18 day old plants were grown hydroponically 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|284022081|sp|B9F3B6.1|SSDH_ORYSJ|SSDH_ORYSJ RecName: Full=Succinate-semialdehyde dehydrogenase, mitochondrial;"
Score 447
Evalue 7.00E-124
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig28145
CGATGGCGATGCGACGCGCGGCGGCGCTCGGCGCCCGCCACATCCTGGCCGCCTCCGCCTCCGCCTCCTCCCGCGTTGCCAGCCGCCGCCACATGGGCAG
CGTGGACGCGGGCGCGGCGATGGATAAGATCCGGGCGGCGGGGCTGCTCAGGACGCGCGGCCTCATCGGCGGCCAGTGGGTGGACGCCTACGACGGGAAG
ACCACCGAGGTGCAAAATCCAGCAACTGGCGAGGTCCTAGCAAATGTGGCCTGCATGGGCAACAGAGAAACAGCTGATGCAATAACTTCTGCTAACACTA
CATTTTATACTTGGAGCAAACTCACTGCAAGTGAAAGGAGCAAGGCACTAAGAAAATGGCATGACCTACTTATGTCACACAAGGAAGAACTTGCACTTCT
TATGACACTGGAACAGGGGAAGCCTATGAAAGAAGCCCTTGGGGAGGTGAACTATGGTGCAAGTTTCATAGAATTTTTTGCTGAGGAAGCAAAGCGTGTG
TATGGTGATATTATTCCCCCTACTCTAGCTGACCGCAGACTATTGGTTCTGAAGCAGCCTATTGGGGTAGTTGGAGCTATTACACCATGGAATTTTCCTT
TAGCAATGATAACCAGAAAGGTTGGACCAGCATTGGCTTGTGGATGCACTGTTGTTGTCAAGCCATCAGAGTTCACACCTCTGACAGCATTAGCTGCAGC
AGACCTTGCTCTTCAAGCTGGAATACCAGCTGGTGCACTAAATGTTGTGATGGGTAATGCTCCTG
page-top