Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig28120  (registered. 2012)
Contig Information
Length 1044 bp
Clones alternative view 146 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 2
Wh_e Seed DPA10 4
Wh_h Spike at heading date 1
Wh_oh Pistil at heading date 1
Wh_r Root 2
Wh_CSEC Callus 3
Wh_DPA20 Seed DPA20 6
Wh_EM Dormant seed with water absorption 9
Wh_EMI Dormant seed with water absorption after breaking 9
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_PCDAM Anther at meiosis 2
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 2
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 2
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 8
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 2
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 10
WH_XN Leaves, plant was grown at constant 23Ž 10
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 11
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 19
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 2
WH_XT Roots, 18 day old plants were grown hydroponically 8
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_SP 1
WH_XA Root 2
WH_XB Root 2
WH_XE Seedling, infected with leaf rust 2
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 7
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 7
WH_XV Leaves, plant was grown at constant 23Ž 4
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit (no hit)
Score
Evalue
Total Hit Count 0
Registered year 2012
Contig Sequence     [ Download ]
>Contig28120
CGGCTTCGGCGAGGAGAACGGCTTCGTGCCCGGTCGTGTCGTGCGGGTGTTGCAGCTTGCTCGTTCTTGCCGAAACAATTGATCTATCCGGTGCCTATGT
AGTTGTGCGTGTGTATCTGGCCAACTCCGTTTGCTAGGTGCACGAGCCAACTTCCAATGAAAATCGATCGGTCTACCTCTCCCCTTATCTCTCCTCTCTT
CCACCGTTCCTCTTTTGAGAGTCGACCAGGGTTGCCCGGCCCGATCCAACGCCTCGTCCGACGGCGCTGCCGGCCGGCGATGGATATGGAGAGGAGCTCG
GGTCTTCCTTGTGTATATTAGGGCAGCAGTAGTTTTAGTTTGTCTTGGCTTCATGCCGTGGTCTGGCGTTATGCCGTGGGGATGCAAACCACTGGAGCTC
TCGAGCGGCGTCTGGTGGTGGCCTCCGTCGTTTTCTTTCTTGCCACCATGGTGGTGGAAAGTGGAAGACGCCGGATCTGGCAAGATCCCCTTGAATAAGC
TCGTTCTGGTGTTGTGGTGTTCCCTGATCTGGAGGGCATCCAACTGCTACTGCTTGTTTTCTCAGGCTACCATGGTGGTGGATGAGAAGCAGGATAGTTG
CAGAATCCTGAAGTTTATAGGTCGAGTTCGAGCATATCAGCAGAGGTCCCTTTGGTGGAGCGACGGCGCCCATCGATGGCTGCCGGTCTTCGTAGGTGCC
CTGTTTCTTCTAGCCGAATGGCGGCTGACTATATTCCTCCCGGCTTGCGTGCCTGATGGGAGGCAGTTCCAGTGGCGGCTCGGAGGCTATGGCGAGCAGG
TGATGCTTCCATGGCGATTTCGTCGTGCCAAGTGGTTCGTCCCCGGCGACGGCGAGGTTCAATCTGGGCGGCGGCTGTCAAGGACCCGATCGCGTTTCTT
GCTTTCAGTCTGGGGTCCTCCTTGTAAAAGTCAGGGACTTAATGTAATGTTCCTTTCTATTTTGGTCCTGTTGTAATATGTACTGCCGTGTTTATCCAAT
GAAGCCTGGGTCCTTCAAGACCCACTTTCTGTTCAAAAAAAAAA
page-top