Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig2811  (registered. 2012)
Contig Information
Length 785 bp
Clones alternative view 41 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 2
Wh_dL Crown of seedling 1
Wh_f Spike at flowering date 1
Wh_oh Pistil at heading date 3
Wh_r Root 1
Wh_CSEC Callus 1
Wh_EMI Dormant seed with water absorption after breaking 3
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 1
Wh_SHC Shoot grown with cold treatment 3
Wh_VSCB Liquid cultured tissue 1
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 2
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 4
WH_SP 1
WH_XA Root 1
WH_XB Root 2
WH_XC Root, treated at 50 microM Al for 6h 6
WH_XD Root, treated at 50 microM Al for 6h 1
WH_XF Seedling, infected with leaf rust 1
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|219362517|ref|NP_001136755.1|| hypothetical protein LOC100216896 [Zea mays]
Score 293
Evalue 1.00E-77
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig2811
GCACGAGGCGGAGGCGGCGCACTCGTGATCTCAACCAGGCGCGCACTTCTCCCCCTCTCCGCCGTCGTCGTCTCCGATCCACCGCCGCTCCGCGCGACCA
TGTCGTCGAAGAGGAAGACCAGGGAGCCCAAGGAGGAGAATGTCACCCTTGGACCGGCTGTCCGTGAGGGAGAGCATGTCTTTGGCGTTGCTCACATCTT
TGCATCCTTCAATGACACCTTCATCCATGTGACTGACTTGTCTGGGAGGGAAACCCTGGTGCGGATCACTGGTGGCATGAAGGTCAAGGCTGATCGTGAT
GAATCGTCACCCTATGCTGCTATGCTTGCATCTCAGGATGTTGCTACCCGTTGCAAGGAGCTTGGTATCACCGCACTGCACATTAAGCTCCGTGCCACTG
GAGGCAACAAGACCAAGACACCTGGACCTGGAGCCCAGTCTGCTCTCAGGGCTCTTGCTCGTTCTGGGATGAAAATTGGGCGCATTGAGGACGTGACTCC
AGTTCCCACTGACAGCACCCGCCGGAAGGGAGGAAGGAGGGGAAGGAGGCTGTAGGCTATCTTTCAACTCTACTGGTGGCAATCAAGAAACTTGCTCCTC
TCTGGGTAGTCCTGCTGTTTCTATGAATGTCATGAGGAGCTTTAATTTTGCTCTGTTGAGGATCATTTGCTGTTAGTCCTATGAATGTTGTGTGGATCCT
ATTTTTGGTTCAGAAACTTGTGGTATTTATGCGAAAAACTAGTTTTTCAGTCTATGGAAACCATGAAATGGAGTTAAAAAAAAAA
page-top