Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig28099  (registered. 2012)
Contig Information
Length 807 bp
Clones alternative view 126 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 4
Wh_dL Crown of seedling 10
Wh_e Seed DPA10 2
Wh_h Spike at heading date 4
Wh_oh Pistil at heading date 1
Wh_r Root 1
Wh_yd Spikelet at late flowering 8
Wh_CSEC Callus 3
Wh_DPA20 Seed DPA20 1
Wh_EM Dormant seed with water absorption 7
Wh_EMI Dormant seed with water absorption after breaking 11
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_OKCS Seed DPA5 2
Wh_SHC Shoot grown with cold treatment 9
Wh_SHDr Shoot grown with dessication 4
Wh_VABA Shoot with ABA treatment 4
Wh_VHS Shoot with heat shock treatment 1
Wh_VSCB Liquid cultured tissue 2
WH_XI Two-week old seedlings(22℃ 16L-8D) 1
WH_XN Leaves, plant was grown at constant 23℃ 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XT Roots, 18 day old plants were grown hydroponically 3
WH_SP 5
WH_XA Root 4
WH_XB Root 8
WH_XD Root, treated at 50 microM Al for 6h 11
WH_XE Seedling, infected with leaf rust 8
WH_XF Seedling, infected with leaf rust 1
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 6
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242092324|ref|XP_002436652.1|| hypothetical protein SORBIDRAFT_10g006620 [Sorghum bicolor]
Score 235
Evalue 4.00E-60
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig28099
TTTTTTTTTTCAGCAGTAATATATCGAATCACTTCAGATAAACGATGAGATAAACAGATCATGTTCACCATACGCAGATCAAAATACCTCGAACTTAAGC
TCTGAGTTCAAAACATCACTTGCCACAAGTAACAGATCTAATAATAAAACATGTAAAGATGATAGGGGTACGACGACGACGATGCGGAGGAACCTAGGCG
CGATTGCCACCGCGGGGTCCGTTGAAGGGCTGGCGGTAGGGCGCAGCGGCAGAGGTGGCCTCGGGGGCGCGCTCAACGCCGGGGAGGTCGGCCATGCCGA
GGAACGCCAGCATGTCCATGGTCTCCTTGTCGACGCGGATCTCGTCGACCTCGAGCGCCGACTTCTCCGGCACGAAGTCCATGCGGCGCTCACGCTCCTC
CTCCTGCAGCTTGAGGGAGATGCCGCGCACGGGGCCGCGCTGGATGCGGCGCATCAGATGGGTGGTGAAGCCGGCCACCTTGTTGCGGAGGCGCTTCGAC
TGGAGGATGGAGACCTCCTCGAGCACCTTCTTGTTGGTGTGGAAGTCGAGGGTCATCCGAGAGTAGTACTTCTCGATGACCTGGCGGGAGGTCTTCTTCA
CGGTCTTGGTGCGGACGCGACCCATGGCTGCGGCTGCTCCGTCTCCTTCTCCGGCGGCGGCTGGGCGCTGGTTGGTGCGGGGTGCGGCGGCGCGACAAAA
ACCTCGTACGAGAACTTGTATAGAGAANNATTTCCCGCGGCGCAGCAGTTCTTCCATACCAACTTAGCTGCCCGGCGCTGCTATTGGCATAACAACCGGT
ACACCAT
page-top