Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig28044  (registered. 2012)
Contig Information
Length 1239 bp
Clones alternative view 11 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 2
Wh_yd Spikelet at late flowering 1
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_SHC Shoot grown with cold treatment 1
WH_XN Leaves, plant was grown at constant 23℃ 1
WH_XT Roots, 18 day old plants were grown hydroponically 3
WH_XB Root 1
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|226493908|ref|NP_001144369.1|| hypothetical protein LOC100277287 [Zea mays]
Score 546
Evalue 3.00E-153
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig28044
CAGCCCGCTCCCCTTACTTCGCCCCCGAGGAAGGCGCCCGGTGCATCCGCCCAGGGGAGTCACCTGCCGCGGCGCTCCGCCGGATCCTGGCGACGCCAGG
CGCCCACCAGGCGCCCTGCTGCTTCGACGCGCTCGGCGCCCGCCTTGTCGAGCGCGCGGGGTTCCCGATCTGCTTCATGGGCGGTTTCTGTGTTTCTGCC
TCACGACTTGGATTGCCAGATGTTGGATTAATCTCCTATGGAGAAATGGTTGATCAAGGGCGTCTAATCACCGAAGCAGTTTCGGTTCCCGTGATTGGTG
ATGGAGACAATGGTTACGGAAATTCTATGAACATCAAGAGAACTGTAAAAGGATATATTAATGCTGGGTTGGCTGGAATCATGCTTGAAGATCAGGTGGC
ACCAAAAGCATGTGGACACACTGAAGGAAGGAAAGTCATCTCGAGGGAGGAAGCGGTCATGCACATAAAAGCTGCTATAGACACTAGGAAGGAGAGTGCC
TCTGACATTGTTATTGTGGCGAGGACAGATTCCCGTCAAGCTGTTTCTCTTGATGAAGCATTATGGAGAGTTCAGGCTTTTGCTGATGCTGGAGCAGATG
TTCTATTTATTGATGCCCTTGCTTCAATAGAAGAGATGAAGGCATTCTGTGCGGTTGCACCTGGGGTACCAAAGATGGCAAACATGTTAGAAGGTGGTGG
TAAAACTCCCATATTGACCCCTGCTGAACTCAAGGAGATTGGTTTTAGCCTTGTAGTCTACCCGTTGTCCCTAATTGGGGTGGCAATGCGTGCAATGGAG
GATGCTCTACTCGCCATAAAAGGTGGTGGTGTACCCTCACCTGCCAGCCTCCCATCTTTTCAGGAGATCAAGGATACTCTAGGGTTCAACCGCTATTACC
AGGAAGATAAACAGTACACTGTCCCTCAAGCCCAACCATTGATGCCAAGTGGTAACCCGTAGAAAGGAGCGGCCCTGTTCAATTCTCAGGAGGCATATGG
AAATGGGATCCAGGTGTCCACTGAGCGATCAGTATCCATTTGCTTTCGAGAATTTGAGATTTGTACCTCTGGGCAATGAGGCAGAGCAATCGCGTTTATC
TTGAGGCAGACGATTTTAGCAACTTGTAAATGAGGCGGCGTGACAAAATGTTTGTAAATGTATGCTGCTTTGGTGTCAGCAAACCTGGATTCCTTGTGTT
AATTTTCAATTTCAACAAAATAAACCACCTTCGAAGTTG
page-top