Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig2802  (registered. 2012)
Contig Information
Length 923 bp
Clones alternative view 16 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 2
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 2
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 7
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XA Root 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|189172063|gb|ACD80387.1|| WRKY40 transcription factor [Triticum aestivum]
Score 451
Evalue 4.00E-125
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig2802
TTTTTTTTGGCATAATAATAGGGTAAGGAATGTATTCATTGCTTTTGAAGGTACAAGATGCTGCAGTGTCTCAACAGAAATAACATGAGAGTTTGCAGAA
ATGAAGTCTGCCTTCTGAATTAGCAGTGGTATTTCATTTCAATTGAACTAAGAAAATCTTGGCTACATCCCACATGCAAGTATCTGGTGCTCTAGCATGC
GTGTAGATGGGAAAAAACATGTGTATCATATTAGTTCTTTGAGGTAAGATCAATTGCCTTCCACTGATCCATTTACAAAAAATGGAAGAATCTGATAGAA
CCGAATCTCCCTGCATCTATGTCTTCGGAAATGTATGCATCTTGGCACTCGGTGCTGCAGGACTGGAGATCAGCACAGGCTGTCTTTTGCTCCACAACGC
CAGGGGCCCAGGAAGAAAGCGCCTCTGAACGCAGCGCAAGGGGCTTGTTCTTGCTCTCGGAAGGCGTGCCGCGTGGCGCCGCACTCGAAGATGGCGAGCT
GGCATTGGCTCCGGGCTCCTGAGCCCCGGATGAATCAAAGCAGATGGAGACTGCCTTCCCAGATGCGGTCTGCAGCTGGAACTCTGTAGGGGTGAGGGCA
AGGAAGGCGCTGTTGCATGAATGCTCGTTGTAGTATGTGACTTGGTACAATGGGGGGTCGCTGTGATCTTTCTGCTGAATCTGCTTGGTGGCCGGGCAAT
TCATGTTGTCTTTGTAGGTGCATCTGTAGTAGTACCTGGGAAAGTTGCAGTTGTTAATCTTCTTCTCGCCGTACTTCCTCCATTGGTGGCCGTCGTTGTG
CGGCGCAAAGGTATCCACCTTCCTCATGCGCTTCTCTTTCCTTGATTCATGGCCTAGAAGTTGTGATTGATGCGGGCTTGGCACGGGGGACATTGTTGCC
CAGTCCCAGAGCAAGAAAGGAAG
page-top