Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig28015  (registered. 2012)
Contig Information
Length 1202 bp
Clones alternative view 121 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 14
Wh_EMI Dormant seed with water absorption after breaking 14
Wh_KMP Shoot grown under continuous light 1
Wh_SHC Shoot grown with cold treatment 3
Wh_SHDr Shoot grown with dessication 10
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_VHS Shoot with heat shock treatment 1
Wh_VWD Shoot grown with dessication 2
WH_XN Leaves, plant was grown at constant 23 11
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 20
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XT Roots, 18 day old plants were grown hydroponically 1
WH_XB Root 2
WH_XC Root, treated at 50 microM Al for 6h 3
WH_XD Root, treated at 50 microM Al for 6h 3
WH_XE Seedling, infected with leaf rust 6
WH_XF Seedling, infected with leaf rust 11
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 9
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XV Leaves, plant was grown at constant 23 1
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|195611406|gb|ACG27533.1|| cation transport protein chaC [Zea mays]
Score 386
Evalue 3.00E-105
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig28015
AAGCAAGCATCACACCTCAGCGTTTTTTTTTTGCTTAAGTCGCCAAATGCATTTATTATTAGGGTATCACAAGGGAAGCAATAACACTTTCAAGTCTCAG
GCTTTCGCATTAGCACTCTGGAAGCTACAGCCTTTGCCAAAGAAAATTAGCGCACACCCTCAATGGTGCCAGAGCTGAAGTAAACCGCAGATCTTTCAAT
GGGAGAATGTCAAGGGTGAGTGTGGTCAGAGGAAAATGCCATCTCTTTCGCCGATCCAGCCGTGCCGCTCTTCTTGCTATGTTGAGACCACGACGGTGCC
CTCAGGAAGAGCAGGGATGTGCAGAACGGGAGTATGCGATTTTAATGGCATGTCGGAGCCGGTAACCTTCTTCTCCGTCGACCTGCTCAGCACCTTCCTC
ACCTCATCCGCAAGCTCAATGATCGTGTCGTCTTCATGGCTTATATTGGACAGTGCCTTCTCCATTGAGAATAGGTAGTCCCTATTATATCCATTAGGGC
CACTGGCTGTAGCAATTTGCCTTGCCATATCCTCCAAAGCAGCAGGGCCAAGATAATATTTGTTGCCAACTGGATCAGGAGTGGATACGAAAACTAATAC
ATCCGTCACAGCTGGTTCCAGAGAATTTCCATCCTTGTAGAAATCCACAGAGATCTTCTGGTCATACTCGCATTCTCTTCTCTCCAAGTACTGCATTGCT
TCTCGTTCTTTTTCTAGACCACCTTTGACACAATAAGCAATTCCCCAGCATATGGCTCCATCTTCGGATTCAAGGGTGCAGGTCCTGGCCGGATGCTGTG
GTGTGCCTCTATGGTCAATGCAAGCGAGATTGAACGTTCGCTTGTAGCCCTTGATGAATCCCAGGATCTTGTCGTCGAAGTCGAATCCGGGGTTCCAGAT
CAGGGACCCATACCCGAATACCCACAGCACCATCCTGGCCGGAGGAGGGGCGCCGGAGAGAATGCCGCGGGTGGGTCGGCGGCGCGGGAGGAGGAGCAAG
ATGGGGATTTGACGCTCCTCTTGCCTCGCCCGCGTCTCCTCTCCTCCGCCGGCGGTCTTCTCCCCCGGACGGACGGGATGGGGGTTTCGGGTCGGAGAGG
GGGGAGAAGACGGTGGCGGTGGTGGGGGAGCACTTATACCGAGAGAGGAGGGGAGAGGATAGTCGTGGGCTGGTTTGGGGATTAGGGTCAGGGGCGGTGG
GC
page-top