Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig280  (registered. 2012)
Contig Information
Length 1331 bp
Clones alternative view 230 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 2
Wh_dL Crown of seedling 1
Wh_r Root 6
Wh_CSEC Callus 7
Wh_EMI Dormant seed with water absorption after breaking 9
Wh_RDr Root of dessiccated seed 2
Wh_SHC Shoot grown with cold treatment 5
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22 16L-8D) 1
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 4
WH_XN Leaves, plant was grown at constant 23 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 10
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 1
WH_XR Roots, 18 day old plants were grown hydroponically 35
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 39
WH_XT Roots, 18 day old plants were grown hydroponically 37
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 36
WH_SP 1
WH_XB Root 2
WH_XC Root, treated at 50 microM Al for 6h 1
WH_XD Root, treated at 50 microM Al for 6h 7
WH_XE Seedling, infected with leaf rust 6
WH_XF Seedling, infected with leaf rust 2
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 8
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 4
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 2
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|84873496|gb|ABC67799.1|| UDP-D-xylose epimerase 3 [Hordeum vulgare]
Score 304
Evalue 2.00E-80
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig280
CACCCACATAGGCAACAGCCGCAAAGTGCATCACAGCATCAAATGCATTTTCAGAAAATATCTTGTTGACAGATTTTTGATCCCCAAGATCTGCATAGAT
GAATTGAAGTCTCCCAGGCTCCGGAAACAATTCTTGGAGAACCTTTACTGCTCCTTTATTTCCTCTAGAAAGATTGTCCACAATGGTAACTCGATAGTTG
TCTTTTAATAGCCGTAATGAGGCATGTGAACCAATATAGCCAGCTCCTCCTGTCACTAAGACATGGGTAACCCCAGGTTCATGACGAGAAAACACACTAT
TGCCACCAAAACCAGGAGATTGCTTCAGAACAAATATACAGAGTGCTATGAAGAGCAGGGCCACAATGACTTTCCCAATATTATGTGGTTTACGCCTAGC
ATCAAAGTACTCCATCCCAGCCCTAGGCTGTGTTCCCCTCCTGTTTGCAGGGATCATGTAAGAATTCTTCTCCTTGAGACGAACTATCTAATGGTGGAAC
CTCTACTCGCCGCCGCCACTGCCGCCGCCTTGATCTTTTTGCCAATGGTGGAATCCCGTGCGCGCGCAGGGAGACAGAGGGAGTGAGGGGCAGCTCCAAT
CAAGCAGGGCGAGAGAGGAGAAGCCTCCGTCCGGGAGGAGAAGTAGGAGAAAACACGGGAGAGGAGGGGGGTCGTTGCAACAGCAGAAAGCATTCTACCA
CTAGACCGACCGCACCAGGTGAAGTGGGAGCTTTGCGCTAAGGGCTCATTAGCAACCATGAAGAGCACCAAGCTCGCGGCGATCCTGATCCTCCAGGCCG
TCCTGGTCATGGGGATCCTCTCACACGTGAACGCCGACTATTTCCCCAAGTGCTGCAACAGTTGCAGGTCCTTCTCGGGGGTCGACGTCTGCGACGACGC
CCACCCCCAGTGCCCCAAGGGCTGCTCGGCCTGCCGCGTGGTGACGCCCAGCCCTCACAAGACGTTCCGGTGCGCCGACATGAAGAGCACCGTCGACGGC
ACCTGCGGCGGGCCATGCAAAAAGCACTGATCCGTTCAGGGCTTCAGGCTCAGACGAGGTGTGCCGCCTAAAATAAAGCTCAGATGAGATGAGCAGTCAT
GGTGCCTATGCTTGTGTGTGGGTCGTGCTATACGGCCAACAGTATGTATAATGCTATCGTCGTGTCTTGGTCAATGTGTTTTCTCTCTCGAGAAAGGCTG
GTGGTGCTAGTACTTGTTCACCTACCTCCGTGAATAAACACATGTGATGATTGTGTGTGCCTACTCAATAACATGAGAACCAGTTCTCTTGTCGAAAAAA
AAAAAATACTCTCCGATATGCAAAAAAAAAA
page-top