Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig27990  (registered. 2012)
Contig Information
Length 791 bp
Clones alternative view 89 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 4
Wh_f Spike at flowering date 1
Wh_oh Pistil at heading date 6
Wh_r Root 1
Wh_DPA20 Seed DPA20 4
Wh_EM Dormant seed with water absorption 2
Wh_EMI Dormant seed with water absorption after breaking 3
Wh_MS Seed DPA5 of DT3DL CS wheat 3
Wh_OKCS Seed DPA5 2
Wh_PCDAM Anther at meiosis 1
Wh_RDr Root of dessiccated seed 2
Wh_SHC Shoot grown with cold treatment 1
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VHS Shoot with heat shock treatment 2
WH_XN Leaves, plant was grown at constant 23℃ 3
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 6
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 4
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 12
WH_XT Roots, 18 day old plants were grown hydroponically 10
WH_XC Root, treated at 50 microM Al for 6h 12
WH_XD Root, treated at 50 microM Al for 6h 2
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 4
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242081227|ref|XP_002445382.1|| hypothetical protein SORBIDRAFT_07g014940 [Sorghum bicolor]
Score 243
Evalue 1.00E-62
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig27990
TTAAGTGTTAATAATGCAGAGACATTTAGTAACAGAGACAAGTTATATAAAGGTTCAGGCATTCAGAAGAGTTCACATTCACGACGACACACTGACGAAA
CGAAACCCAGATACAGAGTTGTTCACAGAAGCTAATAATTACATTCACCCAAACCAAAGCGAAATACCAAACTCCAGGGTTTTCTTAAGTCGCATGATTT
AGTAGACAAGCTTTATTTAGCGGTAAACTTGCCCAGCCAAGCTCCTCTCTTGAAAGACTCGACTCCTGTCAGATGCACGCAGCTTCACTTCTTGCCTCGC
AGCTTTGTGCCAAGAGCCCTTTCCAGCTTGCCGATGATCTGTTGGTTTGGGATAGCCTTGCCTGACTCGTACTCCTGGATGACTTGTGGCTTCTCATTGA
TCAGCTGTGCAAGCTGTGCCTGTGTGAGCTTCTTGTCCGTTCTAGCCTGCATAATGCTCTTCTTCAGGTCTGACGGCACACGCTCATGAGCAAGATTCTC
TGTATCATCATCAAGCCTCTTTGTATTGAGCGATGTGGTGCTATGAGCAGCTTTGTTTGTCCCAGCATTATGCTTCTTGGCGATGTCGATGTCGACGCCG
GCGCGGCGGGCGGCGTTGACGGCCTTCTCGTCCTTCTTGGCGGCGGCGTTGGGCAGCTTCTTGCGCACGACCACCGGCTCCCAGTCCTGGGCGATCGGTC
CGGTGCGAGACATCTCGGCTTGCTCCGGCTTCGGTGGGGCTAGCTAGGGTTTCGCCGAGGTTGGAGACGATGAGGATGTGGTCGGTGCGAA
page-top