Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig27968  (registered. 2012)
Contig Information
Length 1040 bp
Clones alternative view 44 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 2
Wh_yd Spikelet at late flowering 2
Wh_KMP Shoot grown under continuous light 1
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_PCDAM Anther at meiosis 4
Wh_SHDr Shoot grown with dessication 1
WH_XI Two-week old seedlings(22℃ 16L-8D) 2
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 4
WH_XT Roots, 18 day old plants were grown hydroponically 4
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 4
WH_SP 2
WH_XA Root 1
WH_XD Root, treated at 50 microM Al for 6h 6
WH_XE Seedling, infected with leaf rust 4
WH_XF Seedling, infected with leaf rust 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|226507032|ref|NP_001149807.1|| transmembrane BAX inhibitor motif-containing protein 4 [Zea mays]
Score 427
Evalue 1.00E-117
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig27968
TCACAAAGCACCAGTGAGTATATTTTCATCGTGCAGCTTGGTTCAATCACACATTGCATACTCCAGGAAGCTAGGAAACAAGACATGTGATGGAGTCTAG
GACGGCAGAATTTACTGATAACGATTGTACATGCCTACAGGTATCTGCGGGCATTCATGAATTTTCTGATATGCACAAGCTAGTGGACTTAAATCATGCG
ATGTTGGGCAAGGTGCGCTCAGCTATCAGCTGCCCGCAGAATTTGCATCAGATTCAGGAACAGGTTGATGATGTCGAGGTAGAGGGACACGGCAGCCCAG
ATGTACTCGTCATACGTGTGGCGCTTGATGATGTTGTCCGTGTCGAAGATGATGTAGCCACAGAAGATGATCGACGCCACGGCCCCATATATCATGGTGG
AGATCTTGCCCAGTGGGAAAAAGATCTGGATAAGTGAGAACACCAGCAGCACCATAAGAGCTCCAAACAGGAACGGGCCCAGGAAGTTGAAATCATGGCC
TCTCTTTGCAGCCCAGAAAGTGTAGGCAGTCAAGCTGATCACCACCACTGCTGTCAGAATTGCAGCTTCCAAGATGATTTTTCCGCTGGTGAAGGCGCAC
GTCATGCCGACGGCGAAGCTGATGGAGACGGTGAAGACGCCGAGCAGGATGAGGTTGACGGGGTGCTTCTGGTGGTAGTAGCGCAGGGGGCAGAGCACGA
TGAGGGGCAGGACGAGGAGGAAGATGTAGAGGCCCAGGCCAGCGTTGGAGGAGACGAAGAACTCGGAGACGGCGGGGACCTTGACGACGAACCCCGCGAC
GGCGGCGGTCATGGCGAGCTGGACCGAGAGGATGACGTAGATCTTGCGGATGAAGGCCCAGCGCAGCTCCACGTCCTCCGTCATCCCCGGGTAGAGCGCC
GCCGAGCCGCCCGCCTCGAGGTCGAGGTCCGGCGCCTTCCGGTACCCGAACATCGCGCCTCGCTAGGGTTTCGGCCGGGGGTCGTCGGGGACGGGGGGAA
GAGGAAAAGGAAGCAGATGGAGTTGGGCACGCTTCGTAAT
page-top