Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig2793  (registered. 2012)
Contig Information
Length 882 bp
Clones alternative view 37 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 1
Wh_dL Crown of seedling 2
Wh_e Seed DPA10 3
Wh_f Spike at flowering date 3
Wh_h Spike at heading date 1
Wh_oh Pistil at heading date 1
Wh_r Root 3
Wh_yd Spikelet at late flowering 2
Wh_CSEC Callus 3
Wh_DPA20 Seed DPA20 3
Wh_KMP Shoot grown under continuous light 6
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_MS Seed DPA5 of DT3DL CS wheat 4
Wh_OKCS Seed DPA5 1
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|218184182|gb|EEC66609.1|| hypothetical protein OsI_32842 [Oryza sativa Indica Group]
Score 396
Evalue 1.00E-108
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig2793
TTTTTTTTTTAACGCAAGAAAGGCGAAGATGATGCGCCAAAAACTAGTATTACACTTCCAAAAGGTTCAGGCCGAATCAGGTACATATCCACAAGGACCA
AAATTGGAGCAAGTTTGAGGGTACATATCCGTTCCGTTCACATAAAACATGCGCGGCATTCATTATTGCTCAATCCTAAGAGCTTCAACCAGAGTTCATT
CCGGAGGTTAAAACACACCCATTTTCTTCACAAAAACTCATGCAGATCCCCGTTTAGTAGGGCTCCACCGGTGCGCGGAACTTGAGGCCGGCGTACACAG
CGGCATCGCCCAGCTCCTCCTCGATCCTCAGAAGCTGGTTGTACTTGGCAAGACGCTCCGAGCGACAGGGAGCCCCGGTCTTAATCTGACCCGTGGACAA
ACCAACAGCCAAATCAGCAATGAATGTGTCCTCGGTCTCACCACTCCTGTGGCTGGTCATGACACCCCAGCCAGCATGTTTTGACATCTTCACAGCCTCG
ATACTCTCAGTGACGGATCCAATTTGGTTAACCTTCAGCAGAAGAGCATTGCATGACTTCTCCTGGATTGCCTTTGCAACTCTAGTTGGGTTGGTGACTA
GAAGGTCATCACCAACAATCTGAACTTCCACTCCACATTCCTCAGTCATCTTAGCATAGTGCACCCAGTCATCCTGGTCAAATGGGTCCTCAATCGACAC
AATGGGGTACTCGCTCACGAATGACTTGTATACGTTCTTCAGGCTATCTCCAGATATCTTCTGGGAACCATCGTTGTTCTCTTCCTTGAAGTTGAGGTCA
TAGGTTTTGTCCTTGTCATTGTAGAACTCTGAAGCAGCAACATCCATTCCAATGACAACCTTGCCGGTGTATCCAGCCTTCT
page-top