Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig27821  (registered. 2012)
Contig Information
Length 859 bp
Clones alternative view 99 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 4
Wh_dL Crown of seedling 4
Wh_f Spike at flowering date 6
Wh_h Spike at heading date 2
Wh_oh Pistil at heading date 6
Wh_r Root 1
Wh_CSEC Callus 4
Wh_DPA20 Seed DPA20 8
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_KMP Shoot grown under continuous light 4
Wh_KMV Shoot grown with continuous light after cold treatment 5
Wh_OKCS Seed DPA5 2
Wh_PCDAM Anther at meiosis 2
Wh_RDr Root of dessiccated seed 2
Wh_SHC Shoot grown with cold treatment 2
Wh_VABA Shoot with ABA treatment 2
Wh_VWD Shoot grown with dessication 2
WH_XN Leaves, plant was grown at constant 23℃ 4
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 2
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 4
WH_XR Roots, 18 day old plants were grown hydroponically 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 10
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_SP 4
WH_XA Root 2
WH_XB Root 1
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 4
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 2
WH_F/WH_R 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|256708473|gb|ACV20868.1|| thioredoxin-dependent peroxidase [Leymus chinensis]
Score 310
Evalue 1.00E-82
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig27821
ACCAACATACCAGTTAAGACATCACCATGAAAAAAACACTTGCCTGTTGATTTCACAAGGTAATGATGATTCACACAAATACCACCCACACCATTTTCCT
TCAACAATCTCAGAATGTTTGCAACGCAACCAACAATTTGACTGGAAAACTCTGAAGTCACTTGCACCACACATAAAGTACATGAAGAAATGCACATCGA
CAATTTATTCCCACGCAGTTTGGCAGACAAGTTCAAACTACATCGATATGACACAAGGTCTGGGTGATCGCTGCGATTCCGAAGCGCTGAAGCTCCTACA
GTGCCTTGAGGATCTCCTCGGCACCAGAGATTGTGAACTGGCCACCTTCCTCGACGTTTGCGACGGTGACCTTGAGGTCGTCAGCAAGGAGAGCAAACCG
CCTCGAACGGAGACCCAATCCTTTCTCACTAAGATCAAGCTCAAGACCAAGTGCTTTTGTGTATGCTGCCGCTCCATCAGCAAGGAACTTCACATGCTTG
TTATCTGGGTATGTCTTCGCCCATGCTTTCATGACAAAGGGGTCATTAACGCTGACAAGCAGGATCTCATCTACACCCTTGGCTTTGAGCTCCTCGGCCT
GAGTAATGAAGCCTGGTACATGCTGATTGCTGCAGGTGGGGGTGAAGGCGCCAGGGACGCCGAAGAGGATGACCTTCTTGCCGGCGGCCAGGGAGTGGAT
GGAGACCTGCTGCATCTGTTCGCTCTCGTCGAACCACGCGAGCTGGCCGTCGGGGAGGGTGCTGCCCACGCCAATCGGAGCCATGGTTGCGCTTGCTTGC
TCTGGGTTTGGGGAGGGGAGAAGGAGGGGTCTAGAACGGAAGGCAGGCGACAGGGAGGG
page-top