Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig27810  (registered. 2012)
Contig Information
Length 865 bp
Clones alternative view 21 Clones [Download: TSV  ,  FASTA ]
Wh_r Root 1
Wh_SH - 2
Wh_DPA20 Seed DPA20 1
Wh_SHDr Shoot grown with dessication 1
Wh_VABA Shoot with ABA treatment 1
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 1
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 1
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 1
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 2
WH_XN Leaves, plant was grown at constant 23Ž 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 4
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XE Seedling, infected with leaf rust 1
WH_XF Seedling, infected with leaf rust 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242064176|ref|XP_002453377.1|| hypothetical protein SORBIDRAFT_04g004950 [Sorghum bicolor]
Score 359
Evalue 2.00E-97
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig27810
TTTTTTTTTTCAACATAATGATGAACAAGAGCACGCAAATGCGAAGCACAAACTTGCACAAGTACAAGAGCAAGCGGATATTATTAACACGGAAAAGCTC
CATTAGGTCCTTGTTAGCATACAAGGCAACATCTATACGACATTACTTTTACTTGAGGTGTGCAACTTACACAAGACAGAATGCGCACTGGTAAAGGCAC
ACAGACCCCACGCACCGGCAACGATGAACACAATGGCATTGCCTCTTTTCTTCATCCTTACCTGTTTTCTTCCCTAATGCCCGCTGCGATAGTCTAACCT
GCTTTAGTTTCAGTCGGTGGTCATGGGTTCAGCGACGCAGCAGCGGAAGCGTGCTTTACGGACATGGCTCACGACCTCCATCTCGGCGTTCTCAAGCATG
CAGACGATCTCGGTGAATGGTGGGCGAACTTCAGGGTTTGCATCCCAACAGCGCGTCATGATGTGGGTTAGGGAAGGCAGGCAGTCATGTGGGATTGCTG
GACGAGCACCCTTATTTACAACAGCAAAAGCCGCCTGAACAGCTGTCATGTTTGTGAAAGGAAGCATGCCAGTTATAAGCTCCCACAAAACGATCCCGAA
GCTATAGACATCAACTTTATGATCATAAGGCCTGTGCTGGATCATTTCCGGTGCCATCCAGCGGTAGGTTCCTGTCTCTGGTGTCATCCCCTCTGTTTTC
ACTTCAATTCGAGCAACACCAAAGTCAGCAATCTTAATGGATCTGTCTGCTGCAATTAGAAGATTATCCGACTTCAGGTCCCTGTGGATAAATCCCAAAG
CATGCACATACGCCATTCCCCTCGCTACATCCAATGCTTGTTTGACAGCCAGCCTCAAAGCCCGG
page-top