Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig27710  (registered. 2012)
Contig Information
Length 800 bp
Clones alternative view 10 Clones [Download: TSV  ,  FASTA ]
Wh_KMV Shoot grown with continuous light after cold treatment 1
WH_XN Leaves, plant was grown at constant 23℃ 1
WH_XT Roots, 18 day old plants were grown hydroponically 1
WH_XB Root 1
WH_XF Seedling, infected with leaf rust 1
WH_XV Leaves, plant was grown at constant 23℃ 2
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|187471148|sp|A2X980.1|HOX16_ORYSI|HOX16_ORYSI RecName: Full=Homeobox-leucine zipper protein HOX16; AltName:
Score 193
Evalue 2.00E-47
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig27710
AATGAGGCTCTGACTCCGTTCACTTATTTCCCGTACATCACGACAGATTTTACCACCGATGTATTACCCTAACTCGTAGTACAATGCATATGCATACAAC
TTGGTCGATCGTAGTGACCCAAGATTACAGCGGGAAGCATACAAGGAGAGAAAACAAAACGCCACGATTTCTTTTACTGATATACTCCGAAATTGATCGA
TTCCACGGCGCACGCACGCACGCTTCTTGATGCGTGCGCGAGCCTAGTTCCACATCCAGTAGCTGATCTGGCCGTCGTCCTGCTGATCGTCGTCGTCCGT
GTGATGGTGGCCGTGCCCTTGCGCGGCGGCGAAGAAGACGGCGGCGTCGTCGGGGTAGTAGCTGCAGCCCTCGTCGCTGCCCGCGCCGTCGTCCTCCTCC
GACTGGATGCCGCCCGCCACGGGGCCCATCACGCACTCGTGGTACTCGTCGCCGCCGGCGCCCCCCGGGAAGCAGTACGAGTCCACGCTGCTGTCCACCA
CGCCGGCGAGACCGCATCCGCTCCCGAGCAGCGCGTCCCTCGCGTCCAGCACCGCGCTCCCGCCGCTCCCCGGGCTCAGCCTCTCCTCGTCCTTCACATG
CAGCTGCTGCTGCACCACCTCGAACGCCTCCGCTGCCGCGGCATGTTCCTCGGCGTTGGCCAAGGAAGCCTTCGCCTCCGCCGCCGCCTGCTCCGGCTCC
AAGGCGTCGACGGCTGCACCGAAGCTGCCTTCCGGCGCCTCCTTATCTTGCATCTTCTCGGTCAACGTTACCACCTGTGACCGGAGCCGGTGGTTGTCCT
page-top