Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig27663  (registered. 2012)
Contig Information
Length 946 bp
Clones alternative view 16 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 2
Wh_DPA20 Seed DPA20 2
Wh_SHC Shoot grown with cold treatment 2
Wh_VSCB Liquid cultured tissue 3
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XA Root 2
WH_XC Root, treated at 50 microM Al for 6h 1
WH_XD Root, treated at 50 microM Al for 6h 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|108711574|gb|ABF99369.1|| Targeting protein for Xklp2 containing protein, expressed [Oryza"
Score 330
Evalue 1.00E-88
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig27663
ATGAGCACAACACCAGACAAGATGGGGTCATGGAACATGGGACAAATCAGCAAACCACCCAGGCAAGCAAACATCCAGCGGGGCAATGCAATAAGTTCAG
CTCTCAAATTGTTCGTCGAGGGCATCAAACGACCGAGTGACTGACATCCACCTTACATGAATCAACTTAACCGCGAAACACAACGACAGCGGAGACAACG
TTGAGTTAGGGTTTGTACAGCGACATTCGAGCTTGTCTGGCTGCTCCATGGTCCTCCTTCTCACAGGGCCTTCAGCTCACGGGTTTCACAGCTCTGGCTT
TGGCGCCTACGCCGCTCTTCGGCGAGCACTGCGCTTTCTTGGCGTCTTTAGGGTTCCCCATGCTGTGACGATGCGCCCTGTGAGATGCAGCGCTGGTGTT
TGCCGCCTCCGGGGTCGCCAGTGAGCCGTCGCCGGTGCTCTTTCTCCTTGTAAACTTTGGTGACTTGGCACGGGTTGGAGGCACCTTCTTAAGCTCAACC
TTTGGAGGGGGCCCTTCTTGGTAGAAGTTTGGCATGGGTTTTGCTCTGATGACCAAGGACTTCCTTAGTTGTTTTAAAGCCGCTTCTTGCTCATCCTTTT
TCCTTGTTTCAGCCTCATTCTTCTCAGCTTCCAAAGCTTTGTGCTTCTCTTCTAATTTCGTGTAGAACTCTTTCCTCTTGTCAGCACGGTCGTCACATAC
AAATGTAGGAGCAAAGGCAACGGTTGTCTTAGTTCTGCCAGCTCGTGCTGAAGCTGTGGTTGAAGAAGTCACTGAACAGGAGTCGTCATCTTGAGGTTGA
AATGTAAGGCCAGATTGCGACATCTTCTTCGGTGTCACCAGAGTACTCTTCTTTATCATGCTTGCTGGAGAGGCACTGCTTCCTTGCCCAGATTTTTCTC
CATTACTGGATGGATGAGCCACAGCACCATTTCCTCCACCAGAAGC
page-top