Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig27623  (registered. 2012)
Contig Information
Length 1196 bp
Clones alternative view 8 Clones [Download: TSV  ,  FASTA ]
Wh_h Spike at heading date 1
Wh_KMP Shoot grown under continuous light 1
Wh_KMV Shoot grown with continuous light after cold treatment 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XT Roots, 18 day old plants were grown hydroponically 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115461236|ref|NP_001054218.1|| Os04g0671200 [Oryza sativa (japonica cultivar-group)]
Score 480
Evalue 1.00E-133
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig27623
AGAAGCATCTTTGCTTCTCGCCGCCGCCGGTGAGGGAGGGAGGAAGGAAGGAGGCAGGGGATCCCATTGGGTGTTGCCGGTTTGGAGCCAGGGTGATGAG
CTGCCTCACGTTCCGCCGCTCCGCCGCCGACGCAAGCCGCCTCCAGGACGGCCTCCTCGTCTTCATGTTCTTCATCTCGATTCCCATACGTAGTCTGAAT
AATAGTCGTACTAGTAGTAATTCTAGTATTACTAGTAGTAATCTCTTGTAAACGCACGCCGCTCGTGCTCGCGGTTGCGTTCGCGCGGACGGAGGGGCCT
TCTTCTGCTGCTGCTCCGTCTGAATCTTCGTCTTCTTCTTCTCGTCGGGCGACGGTCGCGCCGGCGGCCATGGATCCCAACAGCTTCAAAACCGGAGGCC
TTCTGCTTCCAACCATTGAGAGGCGGTGCGCTTCGCCTCCATCTGTGATCGTGATCGGCGGCGGAATCTCAGGGATTGCCGCGGCTCGTGTCCTCTCCAA
TTCCTCTTTTGAGGTGACTGTCCTTGAGTCGAGAGATCGAATCGGCGGCCGTGTTCACACGGATTACTCCTTTGGATGCCCCATTGACATGGGAGCCTCA
TGGTTGCACGGTGTCAGTAATGAGAATTCTTTAGCACCACTGATAAGCCATCTTGGGCTGAGATTATACCACACTAGTGGTGACAACTCTGTTTTGTATG
ACCATGATTTGGAAAGCTGTTCGCTCTTTGATAAGAACGGCCTTGCAGTCCCAATGGAGACGGCTGCTAAAGTTGGCGTGATATTTGAGAAAATTCTCAA
GGAGACGGTGAAACTCCGTGATGAGCAGGAGCACGACATGCCCCTTGAACAGGCAATCTCGATGGTGCTTGAGAGGCACCCTGATCTCAAGCTGGAAGGG
CTAGATGATCGAATCCTGCAATGGTGCGTCTGCCGGCTGGAGGCATGGTTTGCTGCAGATGCAGATGAAATATCTCTGAAGAACTGGGATCAGGAACATG
TTCTCACTGGTGGCCATGGCCTGATGGTTGATGGATACTTTCCTGTAATTCAGGCTCTCGCTCAAGGTCTCGACATCCGTCTGAATCAGAGAGTGAAGAA
AATTGCACGCCAGCAGAAGGGAGTGACCGTCACCATCGAAGACGGCACGCAATACTCTGCCGACGCCTGCATAATCACTGTGCCGCTCGGTGTGCT
page-top