Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig27586  (registered. 2012)
Contig Information
Length 968 bp
Clones alternative view 6 Clones [Download: TSV  ,  FASTA ]
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 2
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XE Seedling, infected with leaf rust 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|219363735|ref|NP_001136917.1|| hypothetical protein LOC100217075 [Zea mays]
Score 436
Evalue 2.00E-120
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig27586
GAGGCGCTGGGCTCCGACTTCGGCGACGGCGCCAACTTCGCCATCGCCGGCTCGGGCACCCTGCCGCGTGACAGGCCCTTTGCTCTCCACGTCCAGGTGC
AGCAGTTCACCCACTTCAAGCAGCGCTCCCTCCAGCTCATCGCCCATGGCGAGAAGGCACCGGTGGACGCGGAGGGTTTCCGGAACGCGCTGTACCTCAT
CGACATAGGGCAGAACGACCTCTCCGCCGCCTTCTCCATCGGGCTGACCTACGATCACGTGGTCCATCACAGGATCCCGTCCATGCTATATGAGATACAG
GATGCTATCGTGACTCTGTTCTACGATGGAGCCAAGAACTTCTGGGTCCATGGCACCGGTCCGCTAGGCTGCCTGCCGCAGAAGCTCGCCGAGCTCAGGA
ACGACGCCGATGGCGATCTCGACGACAGCGGCTGCCTCAGAACGCTCAACAACGCTTCCCACGAGTTGAACAACCAGCTCAGCTCCGTCTGCCACAAGCT
CACGTCGCAGCTCAAGGGCGCCACCATCGTGTACACCGACGTCCTGTCCATCAAGTACGACCTCATCGCCAACCACAGCGGCTACGGGTTTGAGGAGCCG
CTGATGGCGTGCTGCGGCTACGGCGGGCCGCCTTACAACTACAACGTCAACGTGAGCTGCCTCGACCCCGGCTACCGGGTGTGCGAGGACGGCGCCAAGT
TCGTCAGCTGGGACGGAGTGCACTACACCGACGCCGCGAACGCCGTCGTCGCGGCCAAGATTCTCTCCGCGGAGTTCTCCACTCCCAGTGTGCCCTTCGG
CTACTTCTGCAAGACATGATGGATGCTATACGTACCATTAGATCGAATCAGACATATACGAGCCGCAGATTTGGTGATTTGAGTTTGAAGGGCTCCGTGC
GTTGTAATAGTTGAGACGCATAGCCTAGGGCCTATAATCCTATACCTATACGAAGACTAAAAAAAAAA
page-top