Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig27579  (registered. 2012)
Contig Information
Length 657 bp
Clones alternative view 70 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 1
Wh_dL Crown of seedling 7
Wh_e Seed DPA10 2
Wh_h Spike at heading date 3
Wh_r Root 3
Wh_CSEC Callus 2
Wh_EM Dormant seed with water absorption 6
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_KMP Shoot grown under continuous light 2
Wh_MS Seed DPA5 of DT3DL CS wheat 4
Wh_SHC Shoot grown with cold treatment 1
Wh_VWD Shoot grown with dessication 1
WH_XN Leaves, plant was grown at constant 23℃ 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 4
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 5
WH_XT Roots, 18 day old plants were grown hydroponically 8
WH_SP 3
WH_XA Root 2
WH_XB Root 4
WH_XC Root, treated at 50 microM Al for 6h 4
WH_XD Root, treated at 50 microM Al for 6h 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115451757|ref|NP_001049479.1|| Os03g0234200 [Oryza sativa (japonica cultivar-group)]
Score 259
Evalue 1.00E-67
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig27579
TTTTTTTTTTACCAACGAGGCAAGAATTAACCAGAAAGCAGATCAAATTTTTTTTTTACGGCAAAATTATAGGTTTGCTACCATATACCAATACTGTCAC
TTATCATCACCACAACGATAGGAGGCTGAAAGCAAAGTAAAATAAGGTTCAACGACAACCGAGACGATAATAGCATAAACTCTGACACAGTGATGGATTC
AACCGGTCCATGAAACTGACTAGCAGCACTCTAGTTCTTGATCTTCTTCTTGGGCCTCAGCTGGTTGCTGTGGCCACACTTCTTCTTGCGGCAGTTGACA
GCCCTTGGATGCAGGCGCGCGTAGCATTTGCGGCAGATCATCTTCTCCTGGTTGTACTTGCGGGCAAGAGCCTGCAAGGACGGCTCGATGATGCCTCCAC
GGAGCCTGAGGACGAGATGGAGGGTGGACTCCTTCTGGATGTTGTAGTCGGCAAGGGTGCGGCCGTCCTCCAACTGCTTTCCGGCGAAGATCAGCCGCTG
CTGGTCCGGCGGGATCCCCTCCTTGTCCTGGATCTTGGCCTTGACATTGTCGATGGTATCGCTGCTCTCAACCTCGAGGGTGATGGTCTTCCCCGTGAGG
GTCTTGACGAAGATCTGCATTTTGGCCTCGTGCCGAATTCGGCACGAGGCCTCGTGC
page-top