Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig27566  (registered. 2012)
Contig Information
Length 1091 bp
Clones alternative view 206 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 1
Wh_h Spike at heading date 1
Wh_oh Pistil at heading date 2
Wh_r Root 10
Wh_yd Spikelet at late flowering 4
Wh_SH - 1
Wh_DPA20 Seed DPA20 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 7
Wh_KMP Shoot grown under continuous light 2
Wh_OKCS Seed DPA5 1
Wh_PCDAM Anther at meiosis 6
Wh_RDr Root of dessiccated seed 4
Wh_SHC Shoot grown with cold treatment 3
Wh_SHDr Shoot grown with dessication 2
WH_XN Leaves, plant was grown at constant 23 20
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 10
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 22
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 2
WH_XR Roots, 18 day old plants were grown hydroponically 5
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 3
WH_XT Roots, 18 day old plants were grown hydroponically 8
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 9
WH_SP 7
WH_XA Root 16
WH_XB Root 9
WH_XC Root, treated at 50 microM Al for 6h 5
WH_XD Root, treated at 50 microM Al for 6h 12
WH_XE Seedling, infected with leaf rust 4
WH_XF Seedling, infected with leaf rust 8
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 9
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 8
WH_XV Leaves, plant was grown at constant 23 2
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|42541154|gb|AAS19470.1|| delta tonoplast intrinsic protein TIP2;3 [Triticum aestivum]
Score 497
Evalue 1.00E-138
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig27566
CAGAAGTTTGGCCAGTGGGCATGGGAATGCACTAAACAATGATGCTCTTATTGAATCGCATAAGGAAACTCAACTGAAGAATCTTGAAACCCCAACAACT
TCACAACATCCATCACAGTACAGATACAGAAACATGCATCATCCAAGTGCCACAGCCTCGCGGGCTTTCGATCGGAACCAAACAACATGACGTTCCTCAC
ATCATCCAGACAATCCTGAGAGTGACCACCACGTACGCACTTCTTATGTTGCCGAAGACATTATGGAAACCAAAGACCGAATGATCTTCCCATGGCTGGC
TTAGTAGTCGTTGCCGGCGACGGCGGTGTGGTCGTCGCACATGTACAGGTACCGGTAGACGACGCCGGCGAGGCCACCGCCGATGAGCGGGCCGGCCCAG
TAGATCCAGATGTTGGTGAAGTCGCCGCTGGCAACGGCGGGGCCGAAGGAGCGTGCAGGGTTCATGGACCCGCCGGAGAAGGGGCCGGCGACGAGGATGT
TGGCGCCGACGATGAAGCCGATGGCGATTGGAGCGATGGTGCCGAGGGACCCCTTCTTGGGGTCGGCGGCGGTGGCGTACACGGTGTAGACGAGCCCGAA
GGTGACGATGATCTCCATCACGACGCCCTCGAAGGCGCCCACGCCGGAAAGCCCGTGTGTAGGGGTCGCCACGCCGGTGCAGAACTGGACGAGGAAGGCG
CCGACGATGGCGCCGAGGAGCTGGGCAACCCAGTAGAAGATGCCGGTGAGGATGGTGATCTGGCCGCCGAGGGCGAGGCCGAAGGTGACGGCAGGGTTCA
CATGGCCGCCGGAGATGTTGGCGCCGACGGCGACCGCGACGAACAGCCCGAACCCGTGGCAGATCGCCACGGCGATCAGCCCGGATGGGTCAAGCGGCGC
GCCGCCGCTCACCTTGGAGTAGGCGATGGCAGAGCCGACGCCGGCGAAGACGAAGATGAGGGTGGAGATGAACTCGGCGATGTAGGCCTTGAAAGAGGCC
AAGCTGAAGGAGTCATCGAACCGACCGAAGGCGATGGAGGCAGGCATGGTGGCTTAGAATGGCCCAAAAACCGAGCTGGGGAGGATGAGCC
page-top