Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig27532  (registered. 2012)
Contig Information
Length 856 bp
Clones alternative view 3 Clones [Download: TSV  ,  FASTA ]
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit (no hit)
Score
Evalue
Total Hit Count 0
Registered year 2012
Contig Sequence     [ Download ]
>Contig27532
ACCGCCGACCGCTTCATGAAGACCCACGACCTGGGCACCCGTTGCCGTGCGGCCCGACGAGCAACCGCCGCCACGCTCCTGCCACAAGTGGCCTCGCAAG
CCTGAGCCTCTACACGGTGGCCCCGCTCCCTCGGCGCGGCGGCCTTGCTGGGCGCGTCAGGAGTGCCGTCGGCGGCGGAGACGGCTACGGCCACGGCAGA
GGACGCGCCCAGCTTGCATGGACTGTACCGCGGCGTGTTGAAGGACGTGCTCGCGCGCGAGGTCAGGGGCATGTGCTCACCGGAGCTCAGGGCGCATGCT
CGCGGGGAGAAGGGACGTCGCCTCGCCAGAAGCTAGGGGCGCATGCTCGCGCGGGAGAAGGGTGGCCACCTCACTGAAGCCGTCAGGCCGTCCTTCTCTT
CGGCGGGGCGCATGCTCGCGGGAGGTGGGTCCTCCTGCACCACGCACACGAGCAGCGGCTGCTCGCCGGCCGACGGCTCCACTCTCCCCGTTCCAGCCGA
CGGCTCCACTCTCCCCGTTCCAGCCGACGGCGTCGGGCCCTGCCCCTCCCAGTCACGCACACAACGTGTTTGTTGTAATGTGTGTGAGAGTTAAGAGAGG
GGAAGGAAGAAGACTTGGTCAAGACTCACACGTGGCAATTTTTTTTCGAAGTTAGCTCCTGACTAGCGGGCCCCACCTGTCAGAAACGCGATCAAACGCA
GCCAAGCATGCGATCAGTGCTTTCTGCAAAAAGTTTACTGAAAACACGGTGGTTTTCACGAAAAATTAATGACCTCGTGGTTTTTTGCAAACATGCTCCA
TATGTGGTGGTTTCTTGCAATTNNCTCCCCGATTCTTGATTGATCTTTTACTACTA
page-top