Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig27432  (registered. 2012)
Contig Information
Length 1168 bp
Clones alternative view 17 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 2
Wh_h Spike at heading date 2
Wh_oh Pistil at heading date 2
Wh_PCDAM Anther at meiosis 1
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 2
WH_XT Roots, 18 day old plants were grown hydroponically 3
WH_SP 1
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|28269424|gb|AAO37967.1|| putative vesicle trafficking protein [Oryza sativa Japonica Group]
Score 420
Evalue 2.00E-115
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig27432
CGACACGCGAAGCCGAGCCAGCAGCCCCGCCAAACCCTCCCTCCGGCGACCCCGGCGATCTACTCCCCCGGAGACGGCCGCCGCGTCTCCAGCTGCCGCG
CTCTCTTCCCACCGTGCCTTTATTGGCTATCAACTGTATAGTTTGTAGTGGTTTCTGGGGTTCTTCGCAAAATGGTGAAGCTGACAATGATAGCACGTGT
CACCGATGGCCTTCCGCTGGCAGAAGGGCTGGATGACGGGCGGGATCAGAAGGATTCTGATTTCTACAAGCAGCAAGCTAAACTTCTTTTCAAGAACTTG
TCAAAGGGGCAACATGAAGCCTCACGGATGTCAATTGAGACCGGATCATACTTTTTCCATTACATCATTGAAGGCCGAGTATGCTATCTAACAATGTGCG
ACCGTTCTTATCCAAAGAAACTTGCATTCCAGTACTTGGAAGATCTGAAAAATGAATTTGAGAGGGTCAATGGGAGTCAAATTGAAACTGCTGCAAGGCC
TTACGCTTTCATTAAGTTTGATACATACATACAGAAGACTAAGAAACTGTATTTGGATACCAGAACCCAGAGGAACATTGCGAAATTGAACGATGAGCTC
TATGAGGTGCATCAAATCATGACTCGCAATGTTCAAGAAGTTCTCGGTGTCGGTGAGAAGCTAGATCAGGTTAGTGAAATGTCAAGTAGGTTGACATCTG
ACACGAGAATCTATGCTGATAAGGCAAAGGATCTCAATCGCCAGGCCTTCATTCGGAAGTATGCTCCGGTTGCCATTGTGATTGGGGTTGTAATAATACT
GTTCTGGGCCAAGAACAAGATATGGTGATTCTACTAAACAAGGAAGCCGGCCTGTTATAACACTGGAGAAAGAAATTCTGGATCAAGTGATGCTTCGATG
ACTTGTATCCCGTATCTGCCCGTTCAAGCGAGTAGTTTGAAGCCACCTTTACACCTCGTTACAAGCAGTTATTCAAGTGAATGAATTCGTTGGTTGTAGT
ATAGACCATATGGCGGACTTGATTTTGTGAACCCTGGGAACCGTGCATACAAGAGCTCTGTAGAGTCGAGTTTTCGATATCGGGATCGATTTATATTTTG
TTGTGTCAACTCATGTAAGAATTCAGGCTGATGAAACTATACAGTACTCCATCGCTCCAAAAAAAAAA
page-top