Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig27429  (registered. 2012)
Contig Information
Length 1138 bp
Clones alternative view 5 Clones [Download: TSV  ,  FASTA ]
Wh_VWD Shoot grown with dessication 2
WH_XT Roots, 18 day old plants were grown hydroponically 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit (no hit)
Score
Evalue
Total Hit Count 0
Registered year 2012
Contig Sequence     [ Download ]
>Contig27429
GAGGAGGAGGACCAGGCGGTGGCGCGGCAGCCAGATCCGAGGCGCGTGGGCGCAGAGGCAGCCGCGGTGGGCTCCGGCCTCTTCTTCACGCACGGCGGCA
GGAGCAGCTCCACCTCTCCACTCCCCCACGCGTGAGCCCTCCACAACCCCACCCACCACACCGAGGCGGCGTCCAGAGGCGGTCGGCGGTGGCGCAGGTG
GTCTCCCTCCCGCGCCCTTCTCTTTCCTCTCCTCGACGGCGCCGGTGAGATCCATCCTGTGCCTTCCCTCCTCTCGCGTCCCCCCTCCCCCCACAGCGGC
CCTCCCTGTTGATGGAATCCATCTCTTCTATGCTCTTCTTCTTCCCCTTCCCTGCCTCCCCGGTTCTCAATGATCCCATCTATTTGTACATACTAAGCTA
GCTCAACCACACAGGCAGCTTGATTGGTTCCTATACTAGCAACAGTACGTTTGTGTCTAGGCGGAACCTCCTGTACGTGCGATTTCGTGGAGTCATCTAG
CTCTAGATAGATGCCACTGGACTCCCAGGTTCTTTCCTGTGTAGGAGCTTACTAAATTTTGTAGTTTGCAATGGCTGTTTGGGTGACATCTCAGATTCCC
TTTGAGGTCCTGTATGCGCCTTGTTCAACTTTGGTTCAAATTCATATCATAGTTAGTCCTGCTGCATGATGGAACTAGCTAAGGTGGTTGTTGTTTTGCT
ACCTAATGGGCACAATCTTTTAATCTTTTTCGTTTCCAGGTTCTGATAGATGAGTGATGACTAATGGTTGATGCAAAGGAGGAGGCGTACTGATGGAAGT
TGGCAGCAAAATCAGGACCTCTCCGTCCTCGAGCCCTTCTTCTCCTCTCTCCGCGCTGTCTCGCCTCCCCTGCTCTCGCACCGCCACCTTCCCTGCCCGG
CGCTCGAGGCGCCATGATTTTGGATCGGGCGGATATCTTCACCAGGAGAGTAGGAGCACTTGCTGTTAATATGAACGATCTCTCACTAAGTTTTTGTTAT
GGCGTTGTGTGCCGATTCATGATTTAAACACGCAAAATGTCTGGTTTGCATATTTGTGCCTAGCCCTGTTACCAGCAGTGTATTTTTTGCTGTAAGAAAG
ACAACAATGCTTTATTTCTTTGACTTTTAAAAAAAAAA
page-top