Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig27399  (registered. 2012)
Contig Information
Length 914 bp
Clones alternative view 59 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 1
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_RDr Root of dessiccated seed 1
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_VSCB Liquid cultured tissue 1
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 4
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 2
WH_XN Leaves, plant was grown at constant 23Ž 1
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 2
WH_XT Roots, 18 day old plants were grown hydroponically 3
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 6
WH_XA Root 2
WH_XB Root 1
WH_XC Root, treated at 50 microM Al for 6h 2
WH_XD Root, treated at 50 microM Al for 6h 3
WH_XE Seedling, infected with leaf rust 2
WH_XF Seedling, infected with leaf rust 7
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 12
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 2
WH_F/WH_R 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|15226521|ref|NP_182239.1|| ARF1A1C; GTP binding / phospholipase activator/ protein binding
Score 352
Evalue 3.00E-95
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig27399
AACCGGGGCAGGATCATCATCACTCATCAGGCTCAGGGACACCTGACATGGCATCATTTTCACTATAGCATAAAGGTTTTCCTCGTGTGTACATTCAATC
ATTGATACAACATAGTAACAGTGTGATAACTGCTCAAAGATAGAGCTTACAAAGACATGTCAACACTCTGGCAGCATTTTAACATGCCTACATATTCCAG
TCATTTGTCCAGCCGCTAGTTGCTTCTGCGGCCCTGCCAATCCATTGGAAGCCTTCAGGACTTGCTGGCTATGTTGTTGGAGAGCCAGTCCAGCCCTTCA
TACAGACCCTCTCCACTTGTGGCGCAAGCACTCTGGATATACCAGTGTCGCTGACGCAGAGAGTGTAGACCAAGCTTATCTGTTATTTCAGCAGCATTCA
TGGCATTGGGAAGATCTTGCTTGTTAGCAAAAACAAGCAATACAGCATTGCGCAGCTCATCCTCATTCAGCATCCTGTGGAGCTCATCTCTTGCCTCAGC
AATACGGTCTCTGTCGTTGCTGTCAACAACAAAGATAAGGCCCTGAGTGTTCTGGAAGTAGTGCCTCCACAAAGGCCTTATCTTGTCCTGGCCACCAACA
TCCCAAACAGTGAAGCTGATGTTCTTATACTCTACTGTCTCCACGTTGAACCCGATGGTGGGGATGGTGGTGACGATCTCGCCGAGCTTCAGCTTGTACA
GGATGGTGGTCTTCCCGGCGGCGTCGAGGCCGACCATCAGGATCCGCATCTCCTTCTTGGCGAACAGCGCCCCGAACAGCGTCCCGAACGACAGCCCCAT
CGATCTCCCTACCAAACTTCTCCTCCGCCGCCTCCTCCTCTCCTCTTCTCTCCTCGGATGGAATGGAATCGCCCAAAGCACGAGCGAGTAGAGGCTACTG
AGACACGGAGGGAG
page-top