Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig27367  (registered. 2012)
Contig Information
Length 1570 bp
Clones alternative view 8 Clones [Download: TSV  ,  FASTA ]
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 3
WH_XT Roots, 18 day old plants were grown hydroponically 4
WH_XD Root, treated at 50 microM Al for 6h 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|253761550|ref|XP_002489152.1|| hypothetical protein SORBIDRAFT_0016s002240 [Sorghum bicolor]
Score 427
Evalue 2.00E-117
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig27367
CTTACAAGGATTCCCCTAGTAACGGCGAGCGAACCGGGAGCAGCCCAGCTTGAGAATCGGGCGGCTGTGCCGTCCGAATTGTAGTCTGGAGAGGCGTCCT
CAGCGACGGACCGGGCCCAAGTCCCCTGGAAAGGGGCGCCTGGGAGGGTGAGAGCCCCGTCCGGCCCGGACCCTGTCGCCCCACGAGGCGCCGTCAACGA
GTCGGGTTGTTTGGGAATGCAGCCCAAATCGGGCGGTAGACTCCGTCCAAGGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGCGAGGGAAAG
ATGAAAAGGACTTTGAAAAGAGAGTCAAAGAGTGCTTGAAATTGCCGGGAGGGAAGCGGATGGGGGCCGGCGATGCGCCCCGGCCGTATGCGGAACGGCT
CTTGCTGGTCCGCCGCTCGGCTCGGGGTGTGGACTGTTGTCGGCCGCGCCGGCGGCCAAAGCCCGGGGGCCCTAGGTGCCCCCGGTGGCCGTCGTCGGCA
CGGCCGGTACCCGCGCGCCGAAAGGCGTGTCCCTCGGGGCACTGCGCTGCAACGGCCTGCGGGCTCCCCATCCGACCCGTCTTGAAACACGGACCAAGGA
GTCTGACATGCGTGCGAGTCGACGGGTTCTGAAACCTGGGATGCGCAAGGAAGCTGACGAGCGGGAGGCCCTCACGGGCCGCACCGCTGGCCGACCCTGA
TCTTCTGTGAAGGGTTCGAGTTGGAGCACGCCTGTCGGGACCCGAAAGATGGTGAACTATGCCTGAGCGGGGCGAAGCCAGAGGAAACTCTGGTGGAGGC
TCGAAGCGATACTGACGTGCAAATCGTTCGTCTGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTTCCCTC
AGGATAGCTAGAGCCCATTACGAGTTCTATCAGGTAAAGCCAATGATTAGAGGCATTGGGGACGCAACGTCCTCGACCTATTCTCAAACTTTAAATAGGT
AGGATGGCGCGGCTGCTTCGGTGAGCCGTGCCATGGAATCGGGTGCTCCAAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGGAAG
CCGGGTTACGGTGCCCAACTGCGCGCTAACCTAGAACCCACAAAGGGTGTTGGTCGATTAAGACAGCAGGACGGTGGTCATGGAAGTCGAAATCCGCTAA
GGAGTGTGTAACAACTCACCTGCCGAATCAACTAGCCCCGAAAATGGATGGCGCTGAAGCGCGCGACCCACACCCGGCCATCTGGGCGAGCGCCATGCCC
CGATGAGTAGGAGGGCGCGGCGGCCGCTGCAAAACCCGGGGCGCGAGCCCGGGCGGAGCGGCCGTCGGTGCAGATCTTGGTGGTAGTAGCAAATATTCAA
ATGAGAACTTTGAAGGCCGACGGCAAGGGCTGCGTGCTCCACCTCGACGACGGCGTGACCCACACCAACTGCCGCACGCCCAATATGTAGCTGAATTGTT
GGTTCGAGTTTGAGTTCAATAATGCTCTGCAAGCTTGTTGTCGAATAACGAAAGTGTTCGCGTGTGTGTA
page-top