Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig2736  (registered. 2012)
Contig Information
Length 695 bp
Clones alternative view 5 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 1
Wh_V4816 Shoot grown under cold condition for 16days 1
Wh_VABA Shoot with ABA treatment 1
WH_XF Seedling, infected with leaf rust 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|231274771|emb|CAX36917.1|| MPBQ methyltransferase [Triticum aestivum]
Score 386
Evalue 1.00E-105
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig2736
ATGGGTTCCACCAAGCCACTCCGGCTGATCCAGCACAAGAAGGAGGCCCTCTGGTTCTACAGCTTCATCTCCTTCGGCTACGACCATGTGTTCAACCCAG
GCCAATACACCGAGGACATGCGCGACATCTCCCTGGAGCATGCTCGCCTCCATAGCCGGGCCCTCAAGGTGGTCGACGTCGGTGGTGGCACTGGCTTCAC
CACGCTCGGCGTCGTCCGGTATGTCGACCCCGAGAACGTGACGCTGCTCGACCAGTCGCCGCACCAACTCGACAAGGCCAGAAAGAAGAAGGCCCTCAGG
GGCATCAAGATCATGGAGGGTGACGCCGAGGACCTCCCCTTCCCCGCCGACACCTTCGACCGATACGTCTCCGCTGGCAGCATTGAGTATTGGCCTGATC
CGCAGCGGGGGATCAAGGAGGCCTACAGGGTCCTGAGCGCCGACGGCGTGGCTTGTATGATAGGCCCCGTTCGCCCGACGTTCTGGCTATCTCGCTTCTT
CGCTGACATGTGGATGCTCTTCCCCACGGAGGAAGAGTACATCGAGTGGTTCGAGAGGGCTGGCTTCAAGGATGTCGAGCTCACCAGAATCGGGCCAAAG
TGGTACCGCGGTGCCCNNNNNNNTGGCCTGGTCATAGGGTGCTGTGTCACAGGCATCAAGACACAAAGCGGGGACTCCCCTTTGCAGCTTGGTCC
page-top