Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig27321  (registered. 2012)
Contig Information
Length 853 bp
Clones alternative view 7 Clones [Download: TSV  ,  FASTA ]
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XV Leaves, plant was grown at constant 23℃ 1
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 3
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242037893|ref|XP_002466341.1|| hypothetical protein SORBIDRAFT_01g005960 [Sorghum bicolor]
Score 493
Evalue 8.00E-138
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig27321
TCCTCTAAGAGTGGTGAAGGGTTCGTCGCTGCTAGCCAGGCAATCATGGCGGAGACGGTCACCAATGTATCGGAGTACCAGGCCATCGCGAAGCAGAAGC
TTCCCAAGATGGCCTACGACTACTACGCATCCGGGGCGGAGGACGAGTGGACCCTCAAGGAGAACAGGGAGGCATTCTCCAGGATCTTGTTTCGCCCTCG
CATACTGATTGACGTGTCGACCATCGACATGACCACATCCGTCCTGGGAATGAAGATATCCATGCCCATCATGATTTCCCCCACCGCCTTTCAGAAGATG
GCTCACCCGGAAGGAGAGTACGCAACTGCACGGGCAGCGTCAGCAGCAGGAACTGTGATGACGCTGTCATCGTGGGCTACCTCGAGCGTGGAGGAGGTGG
CCTCGACTGGGCCGGGGATCCGCTTCTTCCAGCTCTACGTGTACAAGGACAGGAAGGTGGTGGAGCAGCTGGTGAGGAGGGCGGAGAAGGCCGGGTTCAA
GGCCATCGCGCTCACCGTCGACACCCCGCGCCTCGGCCGCCGCGAGGCCGACATCAAGAACAGGTTCGTGCTGCCGCCGGGCCTCACGCTCAAGAACTTC
GAGGGCCTCAACCTCGGCACCATGGACCAGGCCAATGACTCCGGGCTGGCGTCGTACGTCGCCGGCCAAATCGACCGCACCCTGAGCTGGAAGGACGTCA
AGTGGCTGCAGAGCATCACCACCATGCCCATCCTCGTCAAGGGAGTCATCACCGCGGAAGACGCTCGGCTGGCCGTCCACTCCGGCGCGGCCGGCATCAT
CGTGTCCAACCACGGCGCCCGCCAGCTCGACTACGTGCCGGCCACCATCAGCG
page-top