Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig27306  (registered. 2012)
Contig Information
Length 1160 bp
Clones alternative view 10 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 1
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XA Root 2
WH_XE Seedling, infected with leaf rust 1
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115462239|ref|NP_001054719.1|| Os05g0160100 [Oryza sativa (japonica cultivar-group)]
Score 577
Evalue 1.00E-162
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig27306
TTTTTTTTTTGAATGTTTAAATTCGGCAGAAATTCATCCATTCAACCAGGAAAATTAACCGATGGAAAAGCGCAATCTGCAGTTTCAATTTCGGTGGGTT
CTTTTGCTTTGCACTACAACTCAAATTAACCGCACGACAATGTTCAGATCCATCCATTCATTCTATGTACATTCAGACTGGCAATTCTCATCAACCATCC
ATCACCCAAGACGAGCTACGAAGGGGTCACCATGATCATGAGATGTAAGCCTTGACGAGGTCGGTGTAGTTGCATTCTTCTCCTGTCCTTGGGCATATGA
TCTTGCCCCCATTCTTCTTGGCCATCTCATCAAGGGCCTTGGTGCTATACACGTAGCCGTTGGGCAGGACAAGCGGCGGATTCTCGGTGTCCATCAGTTC
CTTGGTTATGTGGCAGACAAGCTTCGAGTGGTGCTGCTTTGAGAAGGGCAGTGGCTCTGCGAGTTTCCGGAAGCCGTCCAGTGACAAGGGGTCTTCTTTG
GGGCAGTTGCCCTCGAAGCAGAATGGAGTCTTGAGAGCTGTCAGGCCTGCTTGCAGGTAGATGTTTAGCAACGGCTCAAGCGTCATGCCATATAGTTTGT
AGAATTCTTGCTTAAACTGATCCACAAGAGAATCCCACTGATTTTGCTCAAATAAGACCTTGTATTGAGCACAGTTTGTACTGCTCCTAAAAACCAGTGT
TGCTGTAACACGCTGCAATTCTTTCATGTGGGTAGACCCCCAGGGAGCAAGGTATTTCCGAGCATATGATATAGCCTGCAGGAAGTTCTTAGCCTTGACT
AGTTCCACAAACTCCTGAAGTCGCAGTAAAAACTCGAGCTTACTCTTTGATTTCTTTAACCGGGACTTATTTTCTGCACACCAAGCTAAAGCAGGAGCTA
TTTCCTTATTCCGAAGAGAATCAATCACTCTTTTTGCATCAAGAAAAACATCAATATCAACGAGGTCCTGAATGCCAGAGGTTTCGGCGAGCTTGGTGGC
GGTGTCGTAGTAGGACATCCGGAGCATGTAATCAACTAGGATGCGCTTCAGACGTATGTCCTCCCACTCGGCGTCGTCACCGGCGCTGGCGGCAGCCAGC
CGGTCCAGCCGGGCACGACACCTCTGCACCTGGAGCTCCTCCGCCCTCGCACCCTCCTCC
page-top