Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig27226  (registered. 2012)
Contig Information
Length 1183 bp
Clones alternative view 19 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 2
Wh_r Root 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_SHC Shoot grown with cold treatment 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 2
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_SP 3
WH_XC Root, treated at 50 microM Al for 6h 2
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|42408670|dbj|BAD09890.1|| putative CCR4-NOT transcription complex, subunit 7 [Oryza sativa"
Score 449
Evalue 2.00E-124
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig27226
GTACACATCAAGGGCTGTCCCAAACCTTGATAGATGTCCCATACAGCTCAAAGGGAAAGACCGAGCATTCAACAGAACTACCATGATATAGCAACGAGAG
TCATTTAACTGGGAACAATAGCTATACTATGGCAACCACAAGCAAATATTCAGATCAGAGAGCATATATTCAACAGAAACATTTCCTTTTTTTCAACCAT
AACATTGTCTTATTTGACTATCCATTACTCATTCGATGAGCAGAGCTGCTGGTGGTCTGTTCTCCCCACCATCAGAAATAAGACCATACAATACACCGGC
ATAATTCTCGGTCGATCCTCTGAAATATGCCTCCTTCAGCTTTTGGAAGCACTGCAAGGTCAGCAGCGAGTCGGACCCAGCCTGGTGGCAGATCCCCACA
CGTTGGACACCAAGTAGCTCACCAAGCTTGCTCAAGCCACCATGGAGGCTGCCGCAGTACTTCATGAGATGCTTGATGTCGTACAGCACAGGGAAGTAGA
TTCTGATGAGGTCAAAGAATCCAGGCATGGTGTCGGGTAGGTTCCGCCCGGTTAGCAGCTTGAGCAGGTACCCGAAGTCGTACCCGCTGTGGAATGTGAC
CCACTGGAGCTCAGCGTTGAGCAGGACGCCCGACGACATGAGCAGCTCGGCGAAGTGGCCTGTGTCAGCACCCTCGGTGGTGAAGCGGTCGAAGTCGATC
CCGCTGTTGCGTAGCAGGTCGATGGAGTCAGCGTTGGCGGGGTCTGAGCGCGGATCGAAGCCCCGAAAGTTGAACTGCCAGGCGCAGGGGCGCCCCCCCG
TGCCCCTGGCCGGGAGTGCGCCGTTCTCGTCGGAGAGGGTGAGACCAAGCTGGATGAGGCTCAGCATGTCGACGTTGGCCTTGAGGGTGGCGTAGTTGTA
CTCGTCATTGGAGCGAAAGCTCCCGAGCGGGCGGCACACGATGCCCGGGAACTCGGTGTCCATGGCGATGTACGGGTAATCGTCGACGACGTCACGGATC
ACGGCGAACTCCGCCTCGAGGTTGTTCGCCCATACCTCGCGGATCTCTACGCCCTCCTCGTCGGCGGGCTTACCATCATCGTCGGAGGAGGCGGGGGGTG
GTGGGGCAGACATCGGAGCCGGTGCATCCAAAGATTAGGAGAGAGATCTTGTTGGGGGAGGAGGAGCGAAGCCTCGTGCCGAA
page-top