Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig27210  (registered. 2012)
Contig Information
Length 913 bp
Clones alternative view 10 Clones [Download: TSV  ,  FASTA ]
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XA Root 5
WH_XC Root, treated at 50 microM Al for 6h 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit (no hit)
Score
Evalue
Total Hit Count 0
Registered year 2012
Contig Sequence     [ Download ]
>Contig27210
GCATGTGCAAGTATGAACCAATTTGAACTGTGAAACTGCGAATGGCTCATTAAATCAGTTATAGTTTGTTTGATGGTACGTGCTACTCGGATAACCGTAG
TAATTCTAGAGCTAATACGTGCAACAAACCCCGACTTCTGGGAGGGGCGCATTTATTAGATAAAAGGCTGACGCGGGCTCTGCTCGCTGATCCGATGATT
CATGATAACTCGACGGATCGCACGGCCTTCGTGCCGGCGACGCATCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGGGGCCTACCATGGT
GGTGACGGGTGACGGAGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGCCTTCCTCGCTGGCACCACCAACGGAGATTGCAACTACCGTGTCC
AGGTCAGGACGGATGGCTTTGTTTCTACCTTCACAGGTACAGGGGCAGGTGCCTACCTTGAGTTGTACAACCAGGACCGCGTACGCTTGACCGCGGGTGA
CAGGTTCGACGAGCACAGCGAAGGCACCTTCACCTTCACGAACCAGGAATGTTTGCAGCCGTGCCGCCTCGTCTTCACCCTTTTTGCAAGCAATTTTCCG
GAACAGAGGTTCTGCCAGTACGTCCAAGTCAGCGGAGTCAATGATCAAATCTCGCACTTCGAGGTCAATAAGGTGGTTATCTCTGGCCAGCTCGTCGACG
TCGACAACTGCTAGCTAACACGGCGGCGCCTTGGGCCGTCGTAATATTAATTGCACTGCGTGTGCTCCCGCGCTTTCCATTGTTTGTTACCGTTACACGT
TTAGGTTTGTTAATTTCCCGGTTGTCAGTCGTTGTTTAGTTTGTATTCAAATCAAGCGTTGTTATTTCCTCATTTGAATAATAAGCGGGAAGAGGTTTCA
TTCAAAAAAAAAA
page-top