Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig27197  (registered. 2012)
Contig Information
Length 823 bp
Clones alternative view 9 Clones [Download: TSV  ,  FASTA ]
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XT Roots, 18 day old plants were grown hydroponically 3
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242035279|ref|XP_002465034.1|| hypothetical protein SORBIDRAFT_01g030930 [Sorghum bicolor]
Score 315
Evalue 5.00E-84
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig27197
AAGTTCAGTGAACCTTGAGTTGACAGACACCACACCAACAATGGCCGGAGCAGCAAACGATCTGAAGCTACTGGGCATGTGGGCGAGCCCGTACGTCCTG
CGGGTGCGCCTTGCTCTCAGCATCAAGAGCATCAGCTACGAGTACGCAGAGGAGGACCTCCGGCACAAGAGCGAGCTGCTCCTGCGGTCAAACCCCGTCC
ACAACAAGGTCCCCGTGCTGATCCACGCCGGCAAGCCCGTCTGCGAGTCGCTGGTCATCCTACAGTACATCGACGACGCTTTCGGCGGTGCCGGCCCCGC
CCTCCTCCCGGCCGATCCCCACGAGCGCGCCGTCGCCCGGTTCTGGGCCGCCTTCATCGAGGACACGCTCGTGAAGGCGATGAACCAGGCGTCATGGAGC
AAGACGGAGGCGGAGAAGGTGGAGGGGAACAAACGGGCGACTGCTGCGTTGAACACCCTGGAGGCGGCCCTGAGGGATGTCTCCAAGGGGAAGCCCTTCT
TCGGGGGCGACAGCACCGGGTATGTGGACATCGTGCTCGGCGGCCTCCTCGCGGGGGTGCGCGCCATGGAGGCGATGCTGGGCGTCAAGGCCTTCGACCC
CGTCACGATGCCGCTCCTGGCCGCGTGGGCGGACCACTTCGGCGCGCTGGACGCGGTGGCGGCCGTGATGCCGGACGTGAGCAAGCTCGTGGAGCTCTTC
ATCACGATGCACGCTGCTGTTGCGGCAAACTAATTAGTAGAAAAGATTACCATTATTATTATTATTTTTGTGAAANNNNNNTTAAAACCCGGTCTTTGCA
ATGAATACAACCATCTTATTAAT
page-top