Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig2714  (registered. 2012)
Contig Information
Length 504 bp
Clones alternative view 40 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 4
Wh_e Seed DPA10 1
Wh_r Root 4
Wh_yd Spikelet at late flowering 6
Wh_EM Dormant seed with water absorption 2
Wh_KMP Shoot grown under continuous light 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 4
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 3
WH_XN Leaves, plant was grown at constant 23℃ 2
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 2
WH_CA 1
WH_SP 2
WH_XB Root 2
WH_XE Seedling, infected with leaf rust 1
WH_XV Leaves, plant was grown at constant 23℃ 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115440899|ref|NP_001044729.1|| Os01g0835900 [Oryza sativa (japonica cultivar-group)]
Score 208
Evalue 2.00E-52
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig2714
TTTTTTTTTTCAACGATAAACTAGTTCGATTTCCATTCAATTCCATTCTACAGAAGATAGCAAACAGCAGCGAGATACTGCGATTACATCAACGACCACG
AACCCTAGACACTCTAATCTGGCGGTGATGGTGGCCTAGCCTCCGAATCCGTAGAGGGTGCGTCCCTGGCGCTTGAGGGCGTAGACGACGTCCATGGCGG
TGACGGTCTTGCGGCGGGCGTGCTCGGTGTAGGTGACGGCGTCGCGGATGACGTTCTCGAGGAAGATCTTGAGCACGCCGCGGGTCTCCTCGTAGATGAG
CCCCGAGATGCGCTTCACGCCGCCCCGACGCGCCAGACGACGGATCGCCGGCTTGGTGATGCCCTGGATGTTGTCGCGGAGGACCTTCCGGTGGCGCTTG
GCGCCGCCCTTGCCGAGCCCCTTGCCTCCCTTGCCGCGCCCCGACATCTTTCTCGCTTCTCCTTTCTTCTCCTCGGTGAGGTCGACCTGTCTTTGTGTGG
TAGC
page-top