Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig27130  (registered. 2012)
Contig Information
Length 954 bp
Clones alternative view 19 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 1
Wh_CSEC Callus 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
WH_XI Two-week old seedlings(22℃ 16L-8D) 1
WH_XT Roots, 18 day old plants were grown hydroponically 4
WH_CA 1
WH_XA Root 3
WH_XC Root, treated at 50 microM Al for 6h 4
WH_XF Seedling, infected with leaf rust 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|68037673|gb|AAY84884.1|| alternative splicing regulator [Triticum aestivum]
Score 425
Evalue 3.00E-117
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig27130
CAAATCCAGGTTATATTTTCAGCATTACAAACGGCAATGTTACTGTATTCAAANATCTTCGAGCCAACGACCATAGATAATAATCCAAGTAAAAATGCTG
ACAATGAAGAGAGTACATAAATCTCAAGAATCCATCCAAACAAGTTTTTACAGAAACAAAGGAACCTAGAATAACCGAACACAGAGATAGTACTATAACA
GCGGATGCAGAAGTTGGCGAAGACAAAATTTGAAGAATTTGAAGACCATGGCTCCGCCTCTCACCGCTCCTAGCCTCGCATCCGTTTTACTCTGATTTGG
CATCAGGAGACCGGGAACGTGATGGGCTCTTGCTTGGGTCCCTCTTGGGGCTTGCTGCTTCACCATTGACGACGGGGGACGCAGCGACAGGGGATCGGGA
TTTTGCTGGTGATCTTGATGGAGAGCGTCCCTTTGACGGTGACCTTGAATGGGAAGAAACTGATCTCGACCGAGATCTTGACGCTGAACGGCGTGATGGT
TTTTTCTTTGGACTCGGACTCCTGCTGTAGCTGCCACTTCGGCTTCTGCTACGGCTGCGTGAATAGGAGCGGCTGCTTTTGCCAGCATACTCCTTCACCC
TTATAGGCGCTCGAGAGAATGCATTTTTAAATTCAGTATCATCAAGCTTCCTTATAGCATACTTCATGTCATCATAGTTTGTATAATCAACAATTCCAAT
AGTACCACCACCCTCACGATACACCTCAGAGAAACAAACATCACCAGCCTTTCTCATATGATCCTTTAGATCTTGCCATGATGCAGAAGAAGGTAGTCCA
GTAACCAGAACACGATACTCTGTATGCCTAGAGACACCACCACGGCGTCCTCCGCCACCATAGCTGTTCGNNNNNNATGAAGAGTTGGCCCTCCCGCCAT
GTGCAAGTTCAACCCGCNNNNNNTTCCCATCAAAGTTGTAACCATCTCGACCAT
page-top