Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig27105  (registered. 2012)
Contig Information
Length 1023 bp
Clones alternative view 48 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 2
Wh_oh Pistil at heading date 1
Wh_RDr Root of dessiccated seed 4
WH_XN Leaves, plant was grown at constant 23℃ 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 4
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 4
WH_XR Roots, 18 day old plants were grown hydroponically 8
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 10
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XB Root 6
WH_XD Root, treated at 50 microM Al for 6h 1
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|226499536|ref|NP_001148902.1|| NADH-ubiquinone oxidoreductase 23 kDa subunit [Zea mays]
Score 429
Evalue 3.00E-118
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig27105
CAGTTCATAGCCATGGTTGGTTAATCATCATTCATAACAAACGCAAACACAACATATTGACAGGAAAATAAACTCCACAACCAGTATATTGTTCACGATG
CCATCAGAGTCAAAAATATTTGAATAATCGCAAAAACATGCCGTAAACCTTTACCCTGGAGCATGCTAGTACAACAGATGGAGCACAGGCACAAAAACAT
GGCGCCTTGCTTTCAGGTTATGATACAGGTTTGCTTATTTATCGGCTAGTCGAGCAAAACAGGGGAAATGGCAGACCCAATTTAATGGCAAGAGCAAATC
AACGGTAAAGGGCCTCAGACTTCAGGTTCTCGGCAATCTCGGTCTCCCAGCGGTCGCCGTTCTCGAGCAGTTTCTCCTTGTCGTACAGCAGCTCCTCGTG
AGTTTCAGTAGAGAACTCAAAGTTAGGGCCTTCGACAATAGCATCGACAGGGCAAGCTTCCTGGCAGAACCCGCAGTAGATGCATTTGGTCATGTCAATA
TCGTATCTTGTGGTTCGGCGACTGCCATCTTCACGTTCTTCTGCCTCAATAGTAATTGCCTGGGCTGGGCATATAGCTTCACATAGTTTACAGGCAATGC
ATCGCTCTTCCCCAGTATCATAACGCCTGAGAGCATGCTCACCTCGGAAACGGGGGCTCAAAGGGCCCTTCTCAAATGGATAGTTAATTGTAACTTTCCT
CTCGAAGAAGTACTTGAGCGTCAGCATCAAACCACGGACCATTTCAGTCAAAAACAATGTATTGATACTCCTTTCAAACACAGCACTCCAATCTTTGGCG
AGCTCTTTCGCAAGCTGTTCTTTCTCCTCGTCCTCTTTGAACCTCTTGGGCGCCCCCGCGTCCATGTAGGTCCGGAGGTGGCCCTGCATCGCCGTCGCGG
ACGGGCCGAGACGCGCCGTCTGCCTAGCGCGGAGGGCCAGGGCTGCCTGCCGGGCTAGGAGCGCCGCCATGGTGGCGTCGTCGGCGACGAGGAGGCGGTG
GGTTCGGATCGAAAAGGGGGGTG
page-top