Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig27089  (registered. 2012)
Contig Information
Length 749 bp
Clones alternative view 10 Clones [Download: TSV  ,  FASTA ]
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_VHS Shoot with heat shock treatment 1
Wh_VSCB Liquid cultured tissue 2
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 4
WH_XT Roots, 18 day old plants were grown hydroponically 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|238915387|gb|ACR78191.1|| heat shock protein 17.9 [Pennisetum glaucum]
Score 279
Evalue 3.00E-73
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig27089
AACGAACACAGTCCAGCGACCTCGAGTATTCACGCGAAGACGAGAGAATTCTCCAGAACTGCTTTCTCCTTCTCCGCTATATCATCCCAGCTCTCTATAA
ATTCTCCCTCGTCCCGATCGACAGAAACCGAAGAAAGTCTGAGGAAAGCACCGATCAAAGAGCTCCCAGAAATCAATTGCTCACCCTTCCGCTTCCAACA
CCAGCCAAATCGTCGATCCATTCCACCAGCAGCTCCAATCCCCACCGATACGACCGACAATGTCGCTGATCCGCCGCAGCAACGTGTTTGACCCCTTCTC
CCTCGACTTCTTCGACCCATTCGAAGGCTTCCCCTTCGGCTCCGGCAACAGCGGCAGCGGCAGCCTCGTCCCGCGCACCTCCTCGGACACGGCGGCCTTC
GCGGGCGCGCGCATCGACTGGAAGGAGACGCCCGAGGCGCACGTGTTCAAGGCGGACGTGCCGGGGCTGAAGAAGGAGGAGGTGAAGGTGGAGGTGGAGG
ACGGCAACATCCTCCAGATCAGCGGCGAGCGGAACAAGGAGCAGGAGGAGAAGACTGACACCTGGCACCGCGTGGAGCGCAGCAGTGGTAAGTTCCTGCG
CAGGTTCCGGCTCCCGGAGAACGCCAAGGCGGAGCAGGTGAAGGCGTCCATGGAGAACGGCGTGCTCACCGTCACCGTGCCCANNNNGGAGGCCAAGAAG
CCCGAGGTCAAGTCCATCCATATCTCCGGCTAGAGCGATGAAGTGGAGT
page-top