Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig2705  (registered. 2012)
Contig Information
Length 1378 bp
Clones alternative view 33 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 1
Wh_h Spike at heading date 5
Wh_oh Pistil at heading date 1
Wh_r Root 6
Wh_SH - 1
Wh_DPA20 Seed DPA20 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_KMP Shoot grown under continuous light 2
Wh_PCDAM Anther at meiosis 1
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 5
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 2
WH_XC Root, treated at 50 microM Al for 6h 3
WH_XD Root, treated at 50 microM Al for 6h 1
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115466512|ref|NP_001056855.1|| Os06g0156600 [Oryza sativa (japonica cultivar-group)]
Score 660
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig2705
TTTTTTTTTTGAACGCTCCAACCACACCTTTCATCTTTCATCAAACATTCAATCGAGCACATAAATAACCGCCGAATCTCATTCAGCCCAAGCGCAAATT
ACACGAGAATTAATCAAATCGATGCTTATTCTCGCAACACATCTTCTTCTTCTTCTGTCCCTGCTAAAAATAATAGTAATCCATTCCCTCCCCAGCTTTG
AGGAAGGAAAGGAACAACCAAACGACAAGCTAGCGGGAGCTCGCTCTAGCCTCTAGGAGAGGATGGCCGGGTGGCAGTAGGGCCCGTTGACCCAGCCGTC
GGCGATCTTCTTGTAGGCCGCCTCCGTCAGGTGGATCCCGTCCCAGCTCAGCGACGACGACGGGTTGCCGCACGCCGACGCGCCGGACATGCCGCACCTG
GCGCCGTTCTGGTAGTTGTACTTGCCGCCGCCGGCGCCGCAGCACGCCCTCAGGTTCGTGCTGAACCCGTAGCTGGTGGGGCTCTTGACCATGTCGAAGA
CGTGGGAGTAGAAGTCGGCGTACATGATCTTGGCGTAGGGGTACTTGCTCTGCAGGCTGCTCACCTTGCTCTGGAGCAGCGAGTTGTGTCGGGCCGACAG
CGCGTTGAACCGCTTGAGGCAGCCGTACTGGTCGTAGTCGCCGGCGTTGGAGGTCTGGTAGAGCGTGAGGTAGATGGGGAAGCAGCCGACGGGGAGCACC
CCGGGGATAACGACGTACATGGCGCCCAGCCCGATGAGCTTCTCGGCGCCGGCGCCGATGGCGTCCACGATGGTGGGGCTCTGCCCGGCCGCCTGCTCCG
GCGTGTAGCCGCCGAAGAGCTGCGCGTTGTAGTCGTTCCCGCCCAGCTCGCCCAGCACGAACAGGGACTTGGACAGGTACGTCTTGCACGATGAGCCGCA
GACGGAGGGGAGGAGGTTCTGGAACCACTGGATCTGGCTGTCGAGGGGCCCGTTGTTCCAGATCTTGTCGCCGACGCCGAGTGACTGGAAGAAGCTGGAG
CCCATGGCGGTGGCGCCGATGATGGCCATGTTGGCGCCCTGCTTGAAGTTCGCGCCGCCCTGCTTCGACGGCTTCAGCAGCGGCAGCCCGAACTTCTCGG
CGAGGAAGTCGACGACGAGGCGGCCGTCGGAGCAGCGGCAGGTGGCGCGGCCGAAGAAGGTCTCGCCGTAGGGGGGCTGGGTGAGGGTGAGGCCGGCGGG
GGGGCCGTTGACGCAGAGGTTGCCGGTGTCGGACATGGAGTCGCCGAAGCTGTAGATGGCGTTGAACTTCTGGCCGGATACGGCCAGGAAGCACGCCGAG
ACCATCACAAGCGCCACGAGCAGCGGAGAGGACGCCATTGTTGCCTAGCTCGGAGTTCTGGGACTGGGACTACTGATC
page-top