Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig27048  (registered. 2012)
Contig Information
Length 1324 bp
Clones alternative view 16 Clones [Download: TSV  ,  FASTA ]
Wh_r Root 2
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 1
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 4
WH_XR Roots, 18 day old plants were grown hydroponically 4
WH_XT Roots, 18 day old plants were grown hydroponically 4
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|194239081|emb|CAP72304.1|| O-methyltransferase [Triticum aestivum]
Score 538
Evalue 8.00E-151
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig27048
ATATTGTACACAAAGCATATATGATAAGCACTCTGTCTGCATACTATTTCTTCCAAAAGAAAGTTCCACAGGTATCATAAGGTAACAAGACATAACCGCC
TTGCTATTCTATGATCTACCTAGGACTTCTCTTTGGAAAATGACAAGGCGCTCCTTTATTTTTGCATCCTTAGAGCGAGCACACAACAATCCATAACATA
TGTAAACATCTTACTTTGGGAGCACAACCTTATGGATAGACCTCAATGACAGCTCGAGCTCCCAGCTTCTTCACAATCTTATAGCCACTGAACCCCGCCT
TGACGAAGATCTCACTCCAGTCCTTCTCATCGCGCTGTCGGCCTCTTGTCACCACTAGCATGACCATATCCATGAGGTGTTGGGTTTCCAGCATTGGCCC
TGAAACAGATCCAAGCACAATGTCTATGACGATGACTTTTCCTCCTGCATCCCGGGGAGGAACAGCCTTCTTGCATTGTGCCAGGATCTTGACGCAATCC
TCGTCGCTCCAGAAGTGCAGTACAAGCTTGAGCAACACGGCTTGAGCAGGTGGGACAACGTGGAACAGGTCACCGGAAACATACTTAACTGCTCCTTCTT
CAGCGGGAAGAACTTTGTCCATGACCTTTGGAAGGTCCAGCACAGTGCACGTGATGTGAGGGTAGGCCTCGACGATGGACCTCGCGGTAGTCCCATCGCC
ACCGCCGCAGTCAGTGAGAGACTCAAGCCCATCGAACAGCTCATGGCACTGCCGGAGCACGGGGCCGATCCCCATGTGGTCGTGGGCAGCGAGGGCGTCG
TGGAGCAGCTGATCCATCTCCGGGTCGAGGAGCACCATGCTCTCCTCGAAGATGGCCGCGCCATGCACGTCCTCGAACGGCGAGGGAACGGCTCCATCGA
AGTCCTTCCTGAACCAGTCCGCCAGCCCCATAGCCGCCTCCACGTAGTAGCGCGAGGCCGCGGCGCGCACGAGGGCCGTCTGGCTAGCGTCGCCGTCGAT
GCGGACGCCGTCTACCAGGAGGTACGAGAGCGGGTTGAGGCGGTACGTTCCGGCGTCGGTTGCACTGAAGACGCCCGCCGTGGCGAGTTGGCGCAGCAGG
CGGGCGAGGAAGGGCAGCTTGGACGTGGGGAGGGATAGGGCGGCGACGAGTTCGGATGGGGACGCGGCGCCGCCGAGGCGGTGAATGGCAGTGGGGACGC
CAAGGTCGACGGCGCACCGGAGCGCCATAGGCGTGAGGTAGCAGAGGGTGTGGCGCCACAGGTCCGACTGCGCCTGGAGCAGCTCCGTGTCGGTGGGGAC
AAACACCTTCTCTGCCTGGCCTGC
page-top