Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig27026  (registered. 2012)
Contig Information
Length 727 bp
Clones alternative view 16 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 1
Wh_VSCB Liquid cultured tissue 1
WH_XI Two-week old seedlings(22℃ 16L-8D) 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XA Root 1
WH_XB Root 2
WH_XC Root, treated at 50 microM Al for 6h 5
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115435266|ref|NP_001042391.1|| Os01g0214800 [Oryza sativa (japonica cultivar-group)]
Score 329
Evalue 2.00E-88
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig27026
TTTTTTTTTTCCCAAAATCTCCTTCATGTCGTGAACAAACAGAACCAATAAATTAACAATTAACCAATCTGCACAAGGCATGTAGTGTGTTCTGTTCTTT
GACCTCCTTTCCTTTCTCTACAGTAGTGACCCACCCATGTGCAGGCGGCAATGGCATGTACGCAAAAACAAGCCTGTGTACTACTACTAGTGCTGCTACT
CGAGGTTCCGGTTGCCGACGATGGGCGGGTCGGCGAAGGGCCCGTAGAGCCAGCCCCTGGCGATGTGGCCGTAGGACGCCTCCGTGAGGTGGATGCCGTC
CCAGCTCCAGTGGTTGGAGGGGTCGTCGCACGCGTACGCGCCGGGCTCTCCGCACTTGGACGTCAGGTTGAAGTTGTACACCCCCACGCCCGCCGCCCCG
CAGCACGCCCTCGGCTTCTGCCTTAGCATCCCCCATTTCTCGGCGTGGAGGACGAACTGGATGGTGGGCGTGTAGTAGTCGGCGTACATGATGCGCACGT
CGGCGTGCTTCTTCCGGAGCTCCACGATCTTGCGCTGCAGCGCCACGTTGTGCACCCACGACAGCGTGTTGAGGTCCTTGATGCACCCGCTCTTGCCGCC
GTACATCTCCGGCTGCTTCCGGAAGATGGACAGGTACACCGGGAAGCAGCCGATCGGCAGCACCCCGGGCACCACCAGCTCCACCGCCCCCTCCGCGATC
AGCTTCTCGATTCCCTCGCCGATGGAG
page-top