Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig26978  (registered. 2012)
Contig Information
Length 1339 bp
Clones alternative view 68 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 9
Wh_e Seed DPA10 49
Wh_DPA20 Seed DPA20 7
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XV Leaves, plant was grown at constant 23℃ 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|85815954|gb|ABC84361.1|| LMW-GS P-11 [Triticum aestivum]
Score 711
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig26978
GAATAATAAATTAACGCACCAGGTTTGTGACCAGACAAGACGAACTTATGAACTTGCAAGCATGGTAGTCACATCGACGTCCACAGAACGCCGGTATGAA
CATTGTCTAGAGAAAACTTTATTTGTATTTTATTCCAGAATTTAACTACTAGTTTGCGGGTCACACATGACGTTTGTGTGACACTTTATTTGTCACCGCT
ACATCGACATATCCATCGACTAAACAACGGTGATCTAACGACTATATATTACTAGAAATCTTTTCTTATCAGTAGCCACCAACTCCAGTGCCAATGCTGA
ATGGCATAATAGTGGTCGAGCTGTACAACGGCACGTTGACACCGCACATCGTTGGCAAGGTACGGAGTGCAATGGAAGTCATCACCTCAAGTTGAGATAT
CTGGTGTGGCTGCAAGAATATACCCTGTGGTATCTGTTGTTGTTGAGGCTGCTGACCCAATTGTTGTAGTTGTTGAGGTTGTTGGAAAGAACACTGTCCG
AGTTGCTGCTGCTGCTGCGACTGCTGTTGGTGTTGGGAGACACCTTGGCCCGACTGTTGGGGTTGTTGCTGCTGAGGTTGGACAAAACCCTGTTGTTGTT
CTTGCAGGATGATGGAGTAGACGATGGCACGGATTGCCTCAGAGCGGGATTGTTCGGGGATTTGCGGCAGCTGTTGGCAACATTGTTGTTGCATCACATG
GCAACTACTCTGTTGCCACATTTGTGACCTAGCAAGACGTTGCGACATTGCCACATGGCTACACTGCTGTTGGAGGAACACCTTGCATGGGTTTAGCTGC
TGCAAAACGGATGGTTGAACAACAGGGATTTGTTGTTGTGGAAACTGTTGGTGTTGTTGTGGAAAAGGTGGTTGTTGTGAAGATGGTTGTTGCTGCTGCG
AAAATGGTGGTTGTTGTTGTTGTGAAAATGGTGGTTGTTGTGGTAGAACTGGTTGTTGTTGCTGCGAAAATGGTGGTTGTTGTTGTTGTTGTTGTTGTTG
TTGTTGTGAAAATGGTGGTTGTTGTGGTAGAACTGGTTGTTGTTGCTGCGAAAATGGTGGTTGTTGCAGTATAATAACTGGTTGCTGTTGCGGCAGAACT
GGTTGTTGTTGCTGCGAAAATGGTGATTGTTGCAGTATAATAATTGGTTGTTGTTGCTGTGGAAATGGTTGTTGTTGCTGTGAACATGGTGGTTGTTGTT
GTGGTGGTAATGGTTGTTGCTGCCATGGTTTCTCCAAACCAGGGACGCGGCTAGTCTCCATTTGTGCAATGGCACTTGTCGCCGCAATGGCAAGGAGAGC
AAAGATGAGGAAGGTCTTCATGGTGGATTGGTGTTAACT
page-top