Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig26977  (registered. 2012)
Contig Information
Length 1121 bp
Clones alternative view 43 Clones [Download: TSV  ,  FASTA ]
Wh_h Spike at heading date 2
Wh_CSEC Callus 4
Wh_EM Dormant seed with water absorption 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_OKCS Seed DPA5 1
Wh_V483 Shoot grown under cold condition for 3days 3
WH_XR Roots, 18 day old plants were grown hydroponically 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XT Roots, 18 day old plants were grown hydroponically 8
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XB Root 4
WH_XD Root, treated at 50 microM Al for 6h 4
WH_XE Seedling, infected with leaf rust 1
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 3
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 4
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|218194578|gb|EEC77005.1|| hypothetical protein OsI_15333 [Oryza sativa Indica Group]
Score 179
Evalue 5.00E-43
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig26977
GTAGTGGCACATACATATGGATATATTTCTGTGGTATGAAGAAATAACGTGTGACACGATCTAATTTCATTTCTCTCGTTGACTCGAAAGTACAGTACAG
GATCTAACGTGCCAAATCGATTTGCCATGCTGTGCGGTGCTTCCTAGTTTCATTTATTCTTTTTATTCATGAGAAGTACTAGATTCAAGCCTCTAGTTTC
AAGATCCCTTGTACACGCGTAAGCAAAGTACTCCAGATTCAAGCCTCAGCAGTAGTAGTAGTTCAAGCTTGCGACGATAAGCATGGTAGCTTAGTGGCAT
GGCGGCACGAAGCATTTTGCAGGAATCTCGACGTGCGGCACCTTCTCCTCCCCGACAGACACTCCCATCAGAGATCGGCCGGCGCCATGGCAGGTGTAGC
TGCTGCTCATCATCACCAAGCACACCAGCAGCGCCATGATCTGCAGGAACGCCACCAAGCCACGAGCTCTCAGGCTGCTAACTCCGACGGACGAACATGC
CATCTTGCTTGCTGAGAATAGAAGGGGTCCGAGAAGAGAAGAGAATCCAAGGAAGGAGCCGGCGGCGATGGCGTGGCGGGCGAGCCTATCCCGGAACGTG
AAGGAGATCCGCTTCCTCTTCTGCCAGTCTTCCCCTGCCAGCGGCCCCGCCCGGGAGTTCGTGAAGAAGAACTACGGTGACATCAAGACCCGCAACCCCA
CCCTCCCCGTCCTCATCCGCGAGTGCTCCGGCGTCCAGCCTCAGCTCTGGGCGCGCTACGATATGGGTGTGGAGAGGTGCGTGCGCTTGGATGGCTTGAC
AGAAGCCCAGATCGACAAGAAGTTGGAGGAGCTAGCCAAGGCAGGAGTTGCTTAAAGCTAAAAACTGTCAGGCTAGCCAAGTTTTCTTGCGTTAAATCTT
CACAAATAAGAGAAAAGTTAACATGGGATGTTACATTATCTTGATTTCAGTACCATGACTGTACTCGAGTGTTGAATTTGTACAACTGATTGCTGAGAAC
GTAACTATTTTTCCTATCGTTCTTCAAGGACTGTTTTCACCAGATAAGTTCAATTTCTAAAAACCATACTGGTCATACTTAGTATGTTACAGATGTGGTT
TGGTTTGCTCTAAAAAAAAAA
page-top