Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig26918  (registered. 2012)
Contig Information
Length 1087 bp
Clones alternative view 9 Clones [Download: TSV  ,  FASTA ]
Wh_r Root 1
Wh_yd Spikelet at late flowering 1
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_KMV Shoot grown with continuous light after cold treatment 2
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XD Root, treated at 50 microM Al for 6h 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|20152971|gb|AAM13438.1|AF474071_1|AF474071_1 similar to A. thaliana protein BAB01483 similar to kinesin light
Score 603
Evalue 1.00E-170
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig26918
TTTACAACAATCAATCAGACCATTTTTGTATCTCGATACTCAAAACGCTACTACTATTCCCATGTACCCCTCTCACCAAATTTGAATAAACCAATTGATA
CACAAATTCTTAGCGTCATAGTGTTCCTTTTTCTGTTTCAAAAGCTGTAGTTCACTCACGCTGCAACTGTAGTCCTCTTCCCGATGGTGTATGGGTTGGT
CTCTAGAAGATTTTCCAGGGATTTTGCCTTCCTGCTTCTCCCCCGGCCAGCCTCCTTCAGCAACTCGGCAAGCCTCCGTTTCTCGTCGTCGACGTCTGGG
TTCGCCGTACCTAGCTTCTCTTCGCGCATTTCGACGACGTATTCCAAGATCTCAATGGCCTCATCCAGTCTTCCCATTGCATCATAAGTTCCAGCAAGAT
TGCTGTATACTCCTAGAGTATCTGCATGATATGGCCCGTATTCTTGCTCCAGAACAGTTCTAGCTTCCTCGAAGAGTTCTGCAGCTTCATTTATGGAGTA
TCTTTGAACACACGCCAGCCCCATCTGGTTCAGGGCAATACCGAAGAAGGCGGACTTCTTCTCACCACATGTGCGGAGCTTTGTAATCGCACTCTTGAAG
GAGTCATATGCATCGCCATAATTCCCAGAGATGTAGTGCAAGACACCAATCTGAGCTTCAATTCCAGCAATCGTGCTCTGTTGGCCAGCAGAATTATTGT
ACATCTTCAAGGCCTTCTGGAGTAACTTCAGTGCTTGGTCATGCTCATTCATGGTCTCATATATGGCTGAAACATCAGTTAAACCAGTGGCAATTTCTTC
AAGAGACGTGCCTGGAATAGGTTTCTGATAAATTTTGAGAGCATTCTCACAGTATGATTTTGATTCCCTTAGCTTCCCTGTTTTGTTGTATAGATCAGCA
AGCCGCAGAAAAACAGAAGCCACGGTGGCATGATTCTCCCCTTTGCTAGTCTTGAATACTGTAAGAGCTTTCTGGTAAGCACATACAGCCTCGTCATATC
GACCCAATGAGAGATAAATGTCACCAATGCTGCAATCCACTGAGGCCACCTCAGTCTCCTGGCCATTGGCGACCATGGCCATGCTGC
page-top