Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig2690  (registered. 2012)
Contig Information
Length 1313 bp
Clones alternative view 24 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 1
Wh_f Spike at flowering date 1
Wh_SH - 4
Wh_KMP Shoot grown under continuous light 2
Wh_V4816 Shoot grown under cold condition for 16days 5
Wh_VHS Shoot with heat shock treatment 1
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 2
WH_XN Leaves, plant was grown at constant 23℃ 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 2
WH_XD Root, treated at 50 microM Al for 6h 2
WH_XE Seedling, infected with leaf rust 1
WH_F/WH_R 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242039059|ref|XP_002466924.1|| hypothetical protein SORBIDRAFT_01g016780 [Sorghum bicolor]
Score 481
Evalue 8.00E-134
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig2690
GAGGAGATTAAGGAAGAAAACTTGACGAACAATTGTCCATACGTATGCAAAGTCTGACCCACCTTAGTTCAAGCAAGTGAACTAAATTTTCAGAAGTCAC
ATAGAGTACCCCCAAAGGGTACCCCCATTTGCACCCCTATTTATCCCAATATATAGATACAACAGAAAACGAACTCAAGAAATACAGTAGAGAAAAAAGA
AAAGAATTCTGTCAGGCAGTTGAATGATTTCGTTTTATCATTTCCATAACTCCTCCATTGGAAGTCCACGCTCTGCAGCAACGTCTGAGAACTGTCTCAT
CATCTGTGTCGCCTTGACGGTAGCCCTTGCATTGTTGAGGGGATTCTTGCTTCGCAGCTGCTTCCCAAGAGCATTTTCAACTCCAGCCATCTCCAGCACA
ACCCTCACAGCTCCACCTGCAGTGACACCAGATCCAGGGCAAGCAGGCCTCAGCATGACCTTTGCTGCTCCATAGTTCGCCTCAGCTCTGTGCGGGAAGG
TGCAGTACTTGGTTAGTGGCACTGTAACGAGATTGCGGCGGCCGTTCATGCCAGCCTTGGTGATGGCCTCTGAGACTTCTTTGGCCTTGCCGACGCCAAC
ACCAACGTGCCCCTTCATGTCGCCGACCACGACTAGGGCGCGGTAGGAGAGTTGCCTCCCACCCTTGACGACCTTGGTGACTCGGCTGACCTGCACGACA
CGCTCGCTGAACTCGTCGTTGGGGCGCTGGTCCCGGTCCATGTCGACGGGGTCCACCACTTTCACCTCGAACACGTTGTTCCCCATCAACGACTCGCCGC
TGAAGGCCGGCCCGTAGAGCGACTCGTAGGCTGCTGCCACGTCCTCTGGTGATTCCGGCGGCAACTCGTCGAATGGCGCCGGCTCAATGTATCCCTCCGG
TGGTGCCGCGAACTGAAACTCCGTAGAGGACACCGCCTCCGGCTGCGGCTTCTCGTCGTCCTCGTCCCCGAAGGCGGCTTCCGCAGAATCCTCCGCCTCC
CCTTCCTCATCCTCTTCATGGTAGGAGGCCGAACCGTCCCGGGTGGAGAACATGGAGACAGGGAGCAGGAGGCGGCGGGAGGTGGAGATACGGGCTTTGG
GGCAGAGACGGAGGCGCTGTTGAAGGAAGGAGAACAGTGCGGGAACAACGTGGGCGGCAGTGGAGGTGGTGGCCATCGCCATGGCTGTGGCGGCGACCGC
CATTTTGGCAAGTTCTTCGGGTGATGCTCCGGCGAGGGGAGGCGAGGCCGCGAGGGAGGGGGAGGAGCAGAGAAGTGCTGGGGTGGCAATGTGGGAGTTG
CTCGGCTTATCCT
page-top