Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig26877  (registered. 2012)
Contig Information
Length 867 bp
Clones alternative view 31 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 3
Wh_dL Crown of seedling 1
Wh_e Seed DPA10 2
Wh_oh Pistil at heading date 4
Wh_yd Spikelet at late flowering 5
Wh_EM Dormant seed with water absorption 1
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 2
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 1
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XA Root 4
WH_XC Root, treated at 50 microM Al for 6h 2
WH_XF Seedling, infected with leaf rust 1
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|109716218|gb|ABG43091.1|| histone deacetylase HDAC2 [Triticum aestivum]
Score 355
Evalue 4.00E-96
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig26877
TTTTTTTTTTGTCCAAAACCACACAGGATTCATTCAAAACCATGATGACCATAGCATTCCACCATCCAATTCCAATTCCAATTCCGAATCACAGCGGCTT
TTTTGTTTGATTCAACAACCAACGCATCATCACTAACAGCTCAACGGTTTCTCCCTTCCCTTCCCTCAGGATCAGGCTAGCTAGGTAGGTAGGGAACACG
ACAACACAAGGATAGATAGCCTAACACAGCAGCATAACGATAATAATCTCATAGGACAGACAGATCAAAATAATAGTAACTGGAGCCAGCCAGCCAGCCA
ACATCTTCCTCTCCTCTTCACTTGGCCTCGTGCTTGGCCTTGGAGTGCGAAGCTAGAGCGCCCTCGCTGTTGAATGTCTTGCTGCACGACTTGCACGCGA
CCGACCCTCCAGACTTGGGCGACTTCTCGCTGGTAGCCGGGGTCTTGCCTGCCTTCTTGGCCGGGTGAGGAGTCGCCACATGGACAGCTCCCTTCTTGTC
ACCTGTCTTCTGGCCTGACGGTGTTGCAATCTTGGCCTTCTTGTCAGTAACAGGGGTCTTCAACACGCTTCCAGCCGCCCTCTTCTTCCCAGTCTCTGGC
TTCTTGGGTGTTTCTTCTTCCTCCTCATCAGAGCTATCCTCACTATCATCAGAGGAATCATCACCATCCTCACTATCATCAGAATCATCCTCCATGGGAA
TCAATGCTCCATCATCACCAGAGTCATCTTCGCTGTCATCCTCATCACTGTCATCATCGTCATCGCTGTCATCATCCTTCTTAGATTTTCCCACATCCTT
GGCAGCAGCCTTTGACTTTGAATGTGCAGCAGTGTCAATCTTAACCTGCTTCTTCTGCTCCTTGGCT
page-top