Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig26866  (registered. 2012)
Contig Information
Length 867 bp
Clones alternative view 137 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 6
Wh_dL Crown of seedling 16
Wh_e Seed DPA10 1
Wh_f Spike at flowering date 4
Wh_h Spike at heading date 4
Wh_oh Pistil at heading date 1
Wh_r Root 5
Wh_yd Spikelet at late flowering 3
Wh_CSEC Callus 2
Wh_DPA20 Seed DPA20 4
Wh_EM Dormant seed with water absorption 3
Wh_EMI Dormant seed with water absorption after breaking 8
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 3
Wh_KMP Shoot grown under continuous light 1
Wh_KMV Shoot grown with continuous light after cold treatment 4
Wh_PCDAM Anther at meiosis 4
Wh_RDr Root of dessiccated seed 4
Wh_SHC Shoot grown with cold treatment 3
Wh_VSCB Liquid cultured tissue 4
Wh_VWD Shoot grown with dessication 2
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 1
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 4
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XT Roots, 18 day old plants were grown hydroponically 4
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_SP 6
WH_XA Root 11
WH_XB Root 5
WH_XC Root, treated at 50 microM Al for 6h 15
WH_XD Root, treated at 50 microM Al for 6h 4
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115462241|ref|NP_001054720.1|| Os05g0160200 [Oryza sativa (japonica cultivar-group)]
Score 321
Evalue 6.00E-86
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig26866
CCACTCCGCCCCCTAACCCAAACCCTACCCCGCCGCCGCCGTCGCCGCCGCAGCGCGCGGAGGCGACCTCGCACCGCCGCCAAGATGCAGATCTTCGTGA
AGACCCTGACGGGCAAGACCATCACGCTGGAGGTGGAGTCCTCGGACACCATCGACAACGTCAAGGCCAAGATCCAGGACAAGGAGGGCATCCCGCCGGA
CCAGCAGCGCCTCATCTTCGCCGGTAAGCAGCTCGAGGACGGCCGCACCCTCGCCGACTACAACATCCAGAAGGAGTCCACCCTCCACCTGGTGCTCCGC
CTCCGCGGCGGCGCCAAGAAGCGCAAGAAGAAGACCTACACCAAGCCCAAGAAGCAAAAGCACAAGCACAAGAAGGTGAAGCTCGCCGTCCTCCAGTTCT
ACAAGGTCGACGACGCCACCGGCAAGGTGACCAGGCTCAGGAAGGAGTGCCCCAACGCCGACTGCGGCGCCGGCACCTTCATGGCCAACCACTTCGACCG
CCACTACTGCGGCAAGTGCGGCCTCACCTACGTCTACAACCAGAAGGCTTAGAGGTGGCTCGCGTTTGCTCTGCTCTTTTTACCTACCTATCGAGAATCG
AACTCATTTAGATGTGTCCCGTTTGTCTTTTAAACTGAAACCTTGAGTATCATGTTTCCTGAATATTTCATCGCATACTGCTGTAGTGCGATGCGTGCTT
AAATTTTGGTGTCCGTATGCTATCAGTCCAAATGCTTTTAATCTATCCCAAAAAAAAATTCTTATTCTATGCTTTGCTGATCTTAATAAGGTGGTGGGAT
CACGAAAAATGTATCCTGTTGNNACATGTGTTCTTTGGCTTATAACCTTTATGGCAGGTGTTTGTAG
page-top