Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig2686  (registered. 2012)
Contig Information
Length 1493 bp
Clones alternative view 24 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_SHC Shoot grown with cold treatment 1
Wh_V483 Shoot grown under cold condition for 3days 1
WH_XN Leaves, plant was grown at constant 23℃ 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XT Roots, 18 day old plants were grown hydroponically 4
WH_XA Root 1
WH_XB Root 2
WH_XD Root, treated at 50 microM Al for 6h 4
WH_XE Seedling, infected with leaf rust 2
WH_XV Leaves, plant was grown at constant 23℃ 1
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|222630284|gb|EEE62416.1|| hypothetical protein OsJ_17207 [Oryza sativa Japonica Group]
Score 746
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig2686
TTTTTTTTTTCAACTCAAACAGAAGCTCTAATAACATCGACACCAGTTTCGCACATTATTTAGGAGTATGGAAACATGCGGCCACAGCAAGGAAAGGGAA
TTTAACATCATGTAACTACAATCTGCAGCGAAGGTCGCAATTCACAGTTCCGCATACGAAACAAGCTCACAACAAAAAAGAAAAATTGATGTTTCTAGAA
CGCATCGATTCAAAATTATTTCAAAAACTTGCCAATTGTTTCAAGCTGGCAGCTGAACTCATATCAGAAATCACATGTGGATCGCCTTGTCGTAGGTGTT
CATGCACGCCTCCTTCAGGGCCTCACTCACTGTCGGATGCGCGTGGCACGTACGGGCAATGTCCTCGCTGGATGCTCCATACTGAAGTGCAAGCACAGCC
TCGTGGATGATCTCGCCCGCGCCAGGGGACATTATGTGTACGCCGAGGATTCTGTCAGTTTCCTTCTCAGATATCACCTTCACCATCCCTTCGGCATCAT
CAATTGCCTTCGCCCGACTGTTTGCCAGCAGGGGGAACTTCCCAACCTGGTAGGCTACACCAGATGCCTTGACCTGTTCCTCCGTCTTGCCAACGGAGGC
CACCTCTGGGTGCGTGTACACCACGCCAGGTACAGTGTCATAGTCAACATGGCCCTCCTTCCCCGCGATAAATTCAACACATGCAACACCATCCTCCTCG
GCCTTGTGTGCAAGCATCGGTCCAGGTATCGCATCTCCAATCGCGTATACGCCCTTAACATTTGTCATAAAGCGATTGTCGACAAGGATCCTTCCGCCCT
TGTCTGTCTCAACACCAATGGCGTCCAACCCAATACCAGCAGTGTATGGGACTCTGCCAGCAGATACAAGGACAACATCAGCCTCAATGACAGTCTGCTC
TCCACCAGCTGCAGGCTCCACAGTTAACTTGACACCACTTCCAGAGGTATCGACCCCAACTACCTTTGTCTTGAGCATGAACTTAAACTTTTGCTTCTCT
AGCATACGCTGAAACTGCTTCCTTATCTCTCCATCCATTGATGGGACAATATCAGGGGCAAATTCAACCACAGTCACTTCAGACCCTAGCCTGTTCCAGA
CAGAACCCATCTCTAGACCTATGTATCCAGCTCCAATGACCACCAGCTTCTTTGGTATTTCTGTAAGTGCAAGAGCCCCAGTAGATGACACAATCTTCTT
CTCATCAATTGTAACTCCAGGGAGCGATTTCACATCTGAGCCAGTGGCGACAATTATATTCTTCCCTTTGACGATAGTGCTACCACCATCAACTAAATCC
ACAGATACCTCTGACGGAGAGACAAGCTTCCCAAACCCTTTAACATACTCAACCTTGTTCTTCTTGAACAGGCCTTCAATGCCCTTTGTAAGCCCAGAAA
CAGCCTTGTCTTTCTGAGCCATCATTGCAGGCAGATCTACCTCCAGATTGGAGAACTTGACGCCATGGTGTGCAAAAGAAGACTTGCCTCATG
page-top