Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig26857  (registered. 2012)
Contig Information
Length 1324 bp
Clones alternative view 3 Clones [Download: TSV  ,  FASTA ]
Wh_VSCB Liquid cultured tissue 1
WH_XT Roots, 18 day old plants were grown hydroponically 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit (no hit)
Score
Evalue
Total Hit Count 0
Registered year 2012
Contig Sequence     [ Download ]
>Contig26857
TTGGTGGTATGTTACTGAAAAATGTGCCCGAAATATTTGATCGGTCTACTAAGTTGGTAAACGCTCTGAACATCCAAGTGTTGGTGGAGACCGTTTGCGT
GTTACTGCTCCAATTATCTCAGCAAATGCTTCCCGGGCTACTTACCTCTTGACAAAGGTTGTATTTCACAGAAGCATGTATTCTCAGTTTCTCACAGTAG
CCAGAGTGTATCGCTTTTTTATCTGGTAATTCTGTTCTCATTAATGTTAATGTTTCCGTACGAAGCAAAGGGCACTGGTGCTGGATGGATGCCAGCAGCT
ATTCTGGCAATGGTAAATTGCACTTGATTTATAGATGTTTTCATTTTCATATGCCACGGTCTAAGTGGAAATATAAATACTTTTCGATGAAGCTAGGGAT
GCCATTAAGTAGCTTTAGCTTTACCTATCTTTGGGTGGGAACATTACACTCTTCAACAACGAAAGAGAGGGCGAGAGGTGATCCTTCTGCTCTTTACTTG
TGAATCTCTATTTCTTACTAGCTCGGGGAACTTGCACCCAACAAATTAATGGATGATCTTGCAAACCTCATCAAGTATATTAGTAGTTAAACTGTGAATT
TGAAAACAAAAAAATTGTACATTTGTTCGTGTTGAATTTAGATGTGTTCTTGGGCAATAATTGATGGTAGATAATACATGATGGGGGATGGCCTTCATTG
CTACAATTACTTTTCCTATCCCTCCTTAGTTTCTTGGATGTATATTAGTTTTTGTTTGCCCCTTTATTTTTAGGGGAAGTTTTCTTACTGCCACAGCTTG
GTTGTTCTAACATGACAAAATGTTGGATTTAATATCTTGCTAAATACTGGATACTAGCTCATTTTACTTCAGCTCATAAGGAAAGGTCTGTATGCAAAGC
GTGTCATGGGACGGTATGCTGGAATAAACACATATAGCCAGTTCATGTTTACCCTTTTCTTTACACATATGATTGAGACTAGCAAATTCACATATACAAA
TATGTTTCTAGAGCAAGGATGAGAAGCACTCCATAAACAACCACAATTGATGGGATGACGGAACTTTAGGTTTTCACCAGAATCAAGCATCAGTTCAATG
GGAACTGGAATGATGAAAACACTTGTCGTGCCTCAGAGTGTGGCGCCGAAGAGAAGGACGAGCAGTCAGTGGTGTCTTCGTCTTCGCCGATTGTGCTGTG
CGTAGATGCGGAAGACCGGCAACCGACGGCAATATGTTCATGTGGCTTCAAGCATAGGTTATTCATGGAGTTACATAGTTTGAAGTCCCTTTTGTATTAT
TCTTAGGAGAATGGAGTAAATAAT
page-top