Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig26843  (registered. 2012)
Contig Information
Length 761 bp
Clones alternative view 138 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 2
Wh_dL Crown of seedling 10
Wh_e Seed DPA10 2
Wh_f Spike at flowering date 3
Wh_h Spike at heading date 4
Wh_r Root 3
Wh_yd Spikelet at late flowering 8
Wh_SH - 2
Wh_CSEC Callus 4
Wh_EM Dormant seed with water absorption 6
Wh_EMI Dormant seed with water absorption after breaking 6
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_KMV Shoot grown with continuous light after cold treatment 3
Wh_MS Seed DPA5 of DT3DL CS wheat 6
Wh_OKCS Seed DPA5 5
Wh_SHC Shoot grown with cold treatment 4
Wh_V4816 Shoot grown under cold condition for 16days 4
Wh_V483 Shoot grown under cold condition for 3days 1
Wh_VHS Shoot with heat shock treatment 2
Wh_VSCB Liquid cultured tissue 3
WH_XN Leaves, plant was grown at constant 23℃ 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XT Roots, 18 day old plants were grown hydroponically 6
WH_SP 11
WH_XA Root 8
WH_XB Root 16
WH_XC Root, treated at 50 microM Al for 6h 3
WH_XD Root, treated at 50 microM Al for 6h 7
WH_XF Seedling, infected with leaf rust 1
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|218200667|gb|EEC83094.1|| hypothetical protein OsI_28229 [Oryza sativa Indica Group]
Score 306
Evalue 2.00E-81
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig26843
TTTTTTTTTTGGCAGTACAAATTTAAGCGAAACTATTAATGATAGATAGATTCCACAAAACATGTTCAGATCAGGACATTCGGTTTGACAGATAACACGG
AATCAAATCTCGAAACAGCAGCCTGGTAGATTTCAAGTGCGAAAAAGTTCTGACTATGAACTACTCATAAATCAGAGTCTGGGCTTAGGCAGCGATGAAA
GCCTTCTTCCCGCCTCCGGTGGTTCCAGCTGGAACGACCTTCAGGACATTGAATCTCACGGTTTTCGACAGGGGCCTGCACTGGCCAATGATGACATGGT
CGCCTTCCTTGACACGGAAGCAGGGGGAGATGTGAGCTGGGATGTTGGAGTGCCTCTTCTCATACCTCTGATACTTCTTCACAAAATGAAGGTAGTTCCT
GCGAACAATGATGGTCCGGTTCATCTTGGCACTGTGGCAGGTTCCAGCTATGATTCTGCCCCTGATGGCAACAGTTCCAGTGAATGGGCACTTCTTGTCA
ATGTAGGTACCATCGATCGCTTCCCTTGGGGTCTTGAAACCAAGGCCAACACTCTTCCAGAAGCGGTTGCCAGCCTTGCCAGGCCTCTTTGCCTTGTCAG
CCTTCTTCGTGCTGAGGAAAACCTTTGGCTGCTTGAGGAAAGACTTCTCGGTCTGCTCCGCCATGGCTGCGAGGTGGGCTTCGAGGGGCTCGGAGGCGGC
GGCGGCGGCGCGGCGCGGGGATGCGGGAGCAAGGCTCTGAGAGGAGCCTCGTGCGAGAGAG
page-top