Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig26756  (registered. 2012)
Contig Information
Length 735 bp
Clones alternative view 52 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 9
Wh_dL Crown of seedling 9
Wh_e Seed DPA10 2
Wh_r Root 3
Wh_yd Spikelet at late flowering 2
Wh_CSEC Callus 1
Wh_EM Dormant seed with water absorption 3
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 4
WH_XN Leaves, plant was grown at constant 23℃ 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 2
WH_XT Roots, 18 day old plants were grown hydroponically 5
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 4
WH_SP 2
WH_XB Root 1
WH_XC Root, treated at 50 microM Al for 6h 1
WH_XE Seedling, infected with leaf rust 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|125572544|gb|EAZ14059.1|| hypothetical protein OsJ_03983 [Oryza sativa Japonica Group]
Score 295
Evalue 3.00E-78
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig26756
CCGTCGCCCGCGAAGCCCCTGCCACCGGAGATCTCCCGACCTCTCCCGTCGCCGCCCCCCCGGAGATCTCCCGGCCTCTCCCTCCGCCATCATGGGTAAG
ACACGTGGTATGGGAGCCGGGCGCAAGCTCAAGACCCACCGCAGGAACCAGAGGTGGGCTGACAAGGCGTACAAGAAGAGCCACTTGGGCAATGAGTGGA
AGAAACCCTTTGCTGGATCGTCTCACGCCAAGGGCATTGTCTTGGAGAAGATTGGTATTGAGGCCAAGCAGCCTAACTCTGCCATCCGTAAGTGTGCTCG
TGTCCAGCTGGTGAAGAACGGGAAGAAGATCGCTGCCTTTGTGCCCAATGATGGTTGCCTGAACTTCATCGAGGAAAATGACGAGGTACTGATTGCTGGA
TTCGGTCGTAAGGGTCATGCCGTGGGAGATATTCCCGGTGTCAGGTTCAAGGTTGTCAAGGTATCTGGTGTGTCGCTTCTCGCTCTCTTCAAGGAGAAAA
AGGAGAAGCCCAGGTCTTAGATTGCATTTTTGTTAGGCAAGGATGGAATGGACTGTAAGGCTCTGGTCGTTTGAGGAGGAAAGTTGCCTGCTATGTTTAC
AATGTCCTATATAACCTGAAGTTGTACTAGCGAGATTTGTTCCTTCTCTGCTGTTGCTTTCTCTTAACAGTTGCTATTAAGAGTATTGTTTCCATGATCT
GGATATATATTGTTGCTTTTATCTCAAAAAAAAAA
page-top