Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig26742  (registered. 2012)
Contig Information
Length 787 bp
Clones alternative view 4 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 1
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 1
WH_XT Roots, 18 day old plants were grown hydroponically 1
WH_XF Seedling, infected with leaf rust 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|218187834|gb|EEC70261.1|| hypothetical protein OsI_01066 [Oryza sativa Indica Group]
Score 291
Evalue 7.00E-77
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig26742
GCAAATGGATGTGTGTGATGGCATGGTACTGAAGTTGCTCATCTGAGCATTGTATTTAGTCGCTCATGTATCCTGTGCTTGCGCAACTGATGGTGTTTCT
GTCTACGTTGTATCTATAAACACATGGAAATGACACACACAGGCAAGCAAAAGGCAGTTGAGCTGAGAGCTCCAACATCACATGTATGAAGGAATGAGAT
TCGGTGAACATGGAGCTTGATTTTCAACACATTGCAGCGATCAGTACTCGTCCAAGTAATTGTACAGCGACTCGTCGTTCCTCCACCGGCGTCTTGTGAG
CAACGACTTGAGGAAGCCCCGGCCTTTGTTCGATTTTTTCTCCCTCTCTTTCTGGTTTTCATAGTCAGACTGCACCTGCATCGAGGTTTGTCTAAAATGC
TTTGGATCCAGAGGTGGTCTTCTTGCGACTGTGGCAGATCGCGCGAGGGGATTGGGAGGAGTTGGTATTGGCGAACCTGCTCTTGTTTCTTTCGGATTTA
AGTTCACGACTTGGGGTGATGGTGATTTAGCTCGTGCTTTTCGAGAAGGCGACATGGATCGTGATCGATGGTGTGTTTCACGAACTGCTGGAGACTGTGA
ACGGACACTCCTCATCGTTGTCTGCCTACTAACTGGAGTGGACATTGCAGACTGAGACTTGCGCATTTTGCGACCTGTATGTTGCCTGCTGTACCGTGTG
GGCTCTGAAACCGGATGGATAGCGGATTCCACTATATCTGCGCCTGGTAATATGTAACGCCTGTGGTACTGCGGCGCCCTGATAAGA
page-top