Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig26731  (registered. 2012)
Contig Information
Length 764 bp
Clones alternative view 2 Clones [Download: TSV  ,  FASTA ]
Wh_oh Pistil at heading date 1
WH_XT Roots, 18 day old plants were grown hydroponically 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|125602450|gb|EAZ41775.1|| hypothetical protein OsJ_26316 [Oryza sativa Japonica Group]
Score 426
Evalue 2.00E-117
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig26731
TAGTGGAGAAGCCTCTAGAGCCTCCTCAGCGTGGGACCAAACCAAACCGAATCAAGCCGATTATCTGCCGGATCAAATTTCCGAGGGATGGCAACCGGTA
GCGAAGCTGGAAAGCCCGCGGAGGTCGTGCTGGAGTGGCCTAAGCAGGACAAAAAGAGGATGCTGCATGCTGTTTACCGTGTGGGAGATCTGGACCGCAC
CATTAAGTGTTACACAGAATGCTTTGGGATGAAGCTGTTGAGGAAAAGAGATGTTCCTGAAGAGAAGTACACCAATGCGTTTCTTGGGTTTGGACCTGAG
GACAGTAATTTTGCACTTGAGCTGACTTACAATTATGGTGTCGACAAGTATGACATTGGAGCGGGCTTTGGACATTTTGCCATCGCACATGAGGATGTGT
ACAAGCTGGCTGAGACAATTAAATCATCTTCATGTTGTAAGATCACTCGTGAACCTGGTCCTGTCAAGGGAGGGTCCACTGTGATTGCTTTTGCACCAGA
CCCAGATGGTTACATGTTCGAGCTTATCCAGAGGGGTCCGACGCCTGAGCCTCTCTGTCAAGTTATGCTTCGTGTTGGTGACCTTGATCGGTCTATCATG
TTCTACGAGAAGGCCCTTGGGATGAAGCTTCTGAGGAAGNNNNNTGTGCCTCAGTACAAGTACACTATTGCCATGATGGGCTATGCTGNNNNNNATAAGA
CCACTGTTCTGGAGTTGACATACAACTATGGTGTCACAGAATATAACAAGGGCAATGCATATGC
page-top